Transcript Name :
Phyca_LT1534557901
Orientation:
(-)
Number of Exons:
6
Description :
PREDICTED: UPF0505 protein C16orf62-like, partial
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1103
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
2892
Sequence
        4288 bases(100 bases per row)
ctccagagatggcgatgacggcggctccggtggaggctccagcgagcagatggcgcgttggggagcgtcaaatacctcaatcacgtcatgatctggcacc
acgagggttggcagctaaagagacgcatccgttggctattgcatcgacttttacgagtcttagtccagttgattccatgactgcagtggcacctccgctt
atttccgcaacttctgctttaggagactccttttcaaagaggagaagcggcgggttaacgtctccggaacttgtggtactgcaagatggggacatggatc
cgttgggagttctcggaagctctaaaggcgtgatgaccgcggagtctgagcccacacgctcgaaaacgtcgtcaattgacgttatacaaggggatgacaa
accgcttaagcccactgcaatgccaaacacagtgaaattcaagtggaagcaacacacggatcgactactggcgaaatatgcggatcacacgttcaaaatc
aaagcgagcatgctcgaagtgaacgacctcgagaacgagatatcgttcgtccccaagagcgactaccaaaaagcggatgaatctacagaggcgtcagtga
ttaagaaaacgcgtgctcgactggagcagttggaacgaggccaggacaataacggattatcctcggggggagacgaacagaccattgagatctcccaaag
tcagtacgtggccaaggtgaaggagatggaaaaacgattgatctcaagttgggagcaaaaccacaaagtggaggcgctccgcattgcaattaagtgcgtc
aagttactcgcagatacagatacttcgccacaactgtacccttgcgtgtttgtactggtgagtgaagtcttggatgcctttggaagactcgtatttgatc
gtattcacgcgagggcgtcggaagatgagaacaaccagcctcttcccgagccacttggtgaaaattttatgagctccgacgtcaatattcaagcgacgga
aacgtgtcgcaattggttttacaagacggcttgtatccgagagcttcttcctcgaatgttcgtgcttgggttcgaacttgttgccctaactgagttaact
aacaactgtgtctgttatttgaccccagctatatcgaagtagcgttgctagggtgttatcgatttctttgcgatggagaatatccccagatcgtagcgcg
gttatcaaacatgatcaagtacggaatgttttctattggcagctattgaagtatgttcctaacatggttttgtggtcattgtagaggtgtcggggagccg
atggttgctttgtacgcgcgtttgtatctggcgttgaccagctccgagcttctaggcgccacctctccgacagagcaaacggtcgtcgtaagcagcagtt
tgttcgactacttttacgcattcaactggtttcgccaaaacaaattggagcactggttactaactcacaagatggattacgatgaatatctggcgcttca
ttcaccggccgtcgagtggcttgttaaatgtgccgcccctggagcatctcaggtcactttcgacacgctggtggcgcattaccaagaatattccaacagc
tccatggtgctcaaatatttgtgcgagtgttttggcccattttacgcgtcgacacctagcgagatattggaattgatccgcatagcatcaccctctttgg
tttccaagtgtcatctgtacagtcttgtggcagttcagttgagcaatgcgctgactattgcggagaacgaacaaggcggaaaactacagttcttgaacga
ttcctggtcgtccatcacgtctcaacaagatatcacgcagtatatggagtgcgcagcagcttacatgaagctcatcgtcgctcatttttcggtatgccat
ttgcactgattcatattaacagtgtatccgtgtactaataatgtggagtgttttttattgccgacagcatcgagaagccctcattctgctgaaggatatt
gttcgtcatctgaatgctgcaacgccggacgaactcacagggaagacgtacaatctgctaggcgcactcattgaaaacgtggtttttggtgccaagcaac
actacgagttcttgtcgaagctcatcccgtctactgcgttcttggcacttatgggcatgttcaagcgggagtcaagcgtggatgtcgcgaagaaagtatt
gcgcgcgttcgttagcgggggtatgaagaagtcgtccaaccggtccggctccttgcggcttcatgtcgtcggcccagaagcggcagtggctcacaccctt
ttggttgtttgttgtcgcgtacatgacgctctcgactctctcagtactgcgtctgagcgtgctgaagccaaccgagatatatcggcatttatcacacggc
ttggatacgttaatgaaactggatctgaacgtgcgcaagatgaagagcaggaggcgttgttgatgctgtacacggaatgccgtcgcgcgttctataaact
ggaaccgattcaagttctgctgtctacgatggtgttgcgactagcgatgcacgtccacaaacaaattggcgctggggttggaggcaagaaacgtgcgcat
gctcgacggaacttcattcagtcgtgcttggcattcgctcacatcacaatcccatcgattgaatctgctttggagaagctgcaacttctagtgtcagcgg
cgaatgtagcgctggtgacgaactgcatcccacagatggacgcactggtaaaagctactgtcgttctacttgcagatctggacttgagcacgattcaatc
tgctagtcgtagtgaaaattcagcttaccagggtgcaagttgtggtactgtagggctatttggagctgcgggtatctccagttcaagtactgtcgaccgg
atcgttcaagtgatcgctcaattgatgagcgtgttggtgtacgctccctcactgaacgacgacgacgcgttctactttgtgactgcactacgtaaggctg
ttctggagcggatggtgtggataccacagagctcgtcctcaatctcacttcgtcttgaagccggagttgctaaagtgcgtgttctgctcatgctggtcca
gttgtatgccttgtgggcacagaggtcacttcctggtcgtctgattggagtggactcaaatgacgtgctctacggaggtgacgacttgttttttaatgaa
gtgcagacgcgatttagctcaacagtggaggaattggttggagcgattgaggatttaggtgaagaagctgaggagaacgttactgagcaagtggtggctg
ctcagatggaaatgatgctggactttgtcaacctggtggtacctgtgctcgaatacgacgattctcgaccaggaggagctataccagaggagattgcaag
cagtcgacgtcgtaaaaagcctcggactggagtcgcgcaggtacgtaagtgcatgacgtacagccacgagaaagcaaagacattgaagcagacgaagccg
agagaaatgtcgactagccagatgcagaggatcacgtggacctgccgctacttcgacagcacacgcgcctacgtcgctgatttcatgaagggaatgccga
agcgacctgttggtcttcgcctaaatgcgagcagccaagaagccattcaagctcttgcagatgcgcttcgcagccttgcgctgtagttcagagtgcacgc
gtagtataaattgcgactctgtaaggagatggcggttgcctttggatggcgcgacgattctgattggtcacaaaaatgagtcacttcaactggcgacgct
tcaagatcgcaatcagcatacaaaaatcaagtgatttcggccgttacaaaattggaccgttacaaaaactgataacggacggcccttgcaaaatggaagc
ggtcagccgccgctttgtcttggctgttgctactgctcattcccgaatttccggcctcgagctcaagttcatccccaagaagcttcaagtactcatagat
catgggcaagggcaagggaaaggacaaggataagaaggaggagaagaccgctgccaaggacggtgagttgttgctgttggtgatacctggggagattgct
cgtctctaattccttgttgtgtgcagctcccaaggaggagaagggcggcaagaaaggcggcaagaagggaggcaagaagtaacgactttcgctccaagtt
cgcatctactagctgcatgagagtcacttagttaagaagtgccgggtggacgaaccacaagccacacgaataaaatatgattttcacg