Transcript Name :
Aphin_H310_09882
Orientation:
(+)
Number of Exons:
2
Description :
glycosyltransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Major facilitator superfamily domain10.654PS50850
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
*** None ***
InsideOutsideTMhelix
317-392
453-482
545-550
1326-1377
1427-1465
1531-1610
1671-1682
1748-1767
1839-1844
1900-1915
2037-2074
2130-2141
2194-2267
1-293
416-429
506-524
569-1302
1401-1403
1489-1507
1634-1647
1706-1724
1791-1815
1868-1876
1939-2013
2093-2106
2162-2170
294-316
393-415
430-452
483-505
525-544
551-568
1303-1325
1378-1400
1404-1426
1466-1488
1508-1530
1611-1633
1648-1670
1683-1705
1725-1747
1768-1790
1816-1838
1845-1867
1877-1899
1916-1938
2014-2036
2075-2092
2107-2129
2142-2161
2171-2193
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
29
Sequence
        7082 bases(100 bases per row)
CGTCGCCTCAAGCGAGATCGGTCAAGTGCGAATATTGCCCGAACTGGAGCAAGAGGCAGCATCGGCTGCGCAGCGAAGCCTCCGCCCTCGTCTCGACCTT
CTTGCTCTACGTCACACACACGCATCGGATGAAGTCGCGTCCTCCTTCGTCGAAGGATGCGTCCACCCCCCCGCCGTCGTCGACCGGGGACATGACTGTT
CGTCGGTCCGTTCACAAGCAGGCGTCGAAAAACTACTTTAATTTGGAATCCGACATGAAGCGTCAAAGCTCAATGATGGATGCGGACAACCGATTTAGCC
AACGCTTGTCCATGATGAACGTGCTCCCAGGAAAGCAAGCTGCCTTTCAGGATGAGCCGTCGATCGACTACTGTTGCGAAATCCTTCAAGCAAAGTTCGG
GTTCCAACAAGGGTCGGTCGACAATCAGCGCGAACACGTCTTACTCCTGTTGGCAAACTGCGCAGCTCGTGCGAATTCAGGCAGCACCGACAACACGACA
CATCATGTGCGACTACTGCACGATAAACTATTCGGTAACTACAAGGAATGGTGCGCGTTTGTCGGTGCGAAGCCCGTCGCGTACGCGCAAACTCAAGGAG
GGACGCCGCTCACGTCTGTTTTGCACATGGACTTGATGCTGTACTTTTTGATCTGGGGTGAGTCGGCCAACTTGCGTCACATGCCGGAATGTCTGTGCTA
CTTGTACCATCAAATGATGTCGACGCTCATCAAGGAAGCTCTACATTCGGAAGGACGTCCTGCAGGCTGGTTTCTCAACGCAGTGCTGCGTCCTGTATGG
AAAGAAGCGTCGGTGATGCAAAAGAAGAATGCGCTCGGGAAGCACTTGGAGCATACCAAAGTTCGCAACTACGACGACTTGAACGAATTCTTTTGGCGGT
CTGGGTGCCTCAAGATACCCATCGACAAAATTGGTGGCGCGCTGCATTCGACTGCTGGGAAGACGTTTTACGAACACCGAAGCATCTTCACACTCGTGCT
CAACTACTACCGCATCTTCCACTTCAACTTCATGTTTTTGATCGTGTTGGCCGTGCTCAACTACGCCGTCACGGTCAGTCCGAACGGTGGCAAGACCGGG
TTGAACCAGTTCAGCAAGATTGGGACCGTCATTGCACCGTACACAAAGCGCGATCTGAACAAAGCGTGGGCCGTGCTCATCGGGTCGCATGCGTTTTTAA
ACCTGTTCAAGTGCTTCCTCGAAGTTGGCCATGGCTTTCAGTTGCTCACGGACCCCAAGTCGAAGGCGTCGACTTCGTCGCGTTCCATGACGTATGGGCT
GGCGCTGACGCTGCGACTCGTGTGGAACCTTGTGTTTACGGGTGCGTTTGCCCTCATGTTTTCGCTTGGCGCGCCCAAGTCGTCGGGTGGATTTGACTTG
CTCAACTTACTCAGTGTTGCGGCGCTCGTGTACCTTGTTCCAGGGGCAATTATCTTGGTCCTGCAGACGTTTTTCCCTGGCACTGGCCGATCGTGGTTTT
CAAAGTTCATTCGTGAGGGTGACAGCTGCTACACAGGTCGTCACATGGCACCGCCGCTTGCATTCCAGCTCAAGTACTATTTGTTTTGGTTTGTGCTGCT
CGTGTGCAAGGCTGCCGTGTCATACTGGGTGCTTGTGAGTCCGCTCGTGTTGCCGAGTCTAGCGATTTGGGAAATGGAGCTCAAGTATGGCCAGGGATCG
CTGGGGTCGTTCCACAACCTCGGTGTGATTGTCAGCTTGTGGGCCCCCGTCGTGTTCATTTTCAACTACGACACGCAAATCTACTTTACCATTTTCCAAG
CTGGTCTTGGCGCGTTCATGGGCTGGATGATGAAAGTCGGCGAAGTTCGCGGGGTCGACGCGTTGTCGAAAGCTTTCCGAGTCGCGCCGCAGTTGTTTGA
CACAAAAGTTGTGACGGAACTCGCTCGCCTCGCTGATGCCAACGAAGGTGGCGACGAGCATGGCCGCGGCAGCCAGTCGGCGGTGTACCAGTCCCAAATG
ATGCTTCGGTACGTGTTTGAAATATTGGGTAGATGGCCGACTGGATGCGTTGTAGTTTTGTAGTCGTGTGGAACGAAATTGTCAACTCGTTCCGCGAAGG
CGATTTGGTCGATGACAAGGAAGCTGCGATTTTGCAATACGACATCCAAAACACGGGCGAAGTGTTTGAGCCGGTGTTTTTGTCGGCGGGCAAGTTGAAC
GAAGGCATGGCGTATGCGGTCAAATTGGGCAAGGCTGGTCGCGGCGACTCGGAGCTGCGCATTCAGTTGGTCCAAAACGACTGTCTCGGGGCTGTCAAGT
CGTTTTTCAACGCGTCGATGTACGTGCTGGAAGCGCTCTTGGCCCCTGACGACACAGAAACGTTGGACGGATTCCGATTGATGGAGCAAGCTGCGCTCGA
TGGCCAATTCTTGTCGCTCTTTGATGCTGGGTCCCTTCTCCATGTGCGCACGATGGCCATTGACTTTCTTGAAGCCGTGCTCGACTTGCCAGACCCAGAT
TCGGTCAGCCCCGTCCTCAAGACAACGGTGCACCCCATGGGCGTTATTCGCAACTTTGTCGCAAAGATGGACAATTTGTTGAACGGGCTGCGCCTCTTTT
GCCGTCAACCTGCCATGGCAGCCAAGTTTCAAAACGTAAACTTTGTGTCGCCGGCCAACTCGTATGCGTATGCCGCCAAGGGGTTGGTAAATTTGTTTCA
CTCGGACACGGCCATGGGTGCCGCCACGCGCGCATACTTGCTCATGTCGTTGGATCGTCAAGACGCCATGCCCAAGTGTGGCGAAGCGCAGCGTCGCCTC
GGTTTCTTTATGCAGTCGCTGTTGATGGAGATTCCGCAGTTGAGCGCGATTCGCAGCATGCGGTCGTTTTCTGTCGTGACGCCGTTTTACAGCGAAGGGG
TGATCTTTTCGCTGGACGAACTCAACAACCCTCTGGAGAACCACCCGATTTTCAACAAGGCATCGGAAATCGACAAGAAGATTACGATTCTAAAGTACTT
GATCACGATTCACCCGGAAGAGTGGGAAAATTTTCTGGAACGCATTGACGTGTCGACGGTCGATGCCGCGATCAACGAGTACCCGATGGAACTCCGTTTG
TGGGCGTCGTATCGCGGTCAAACGCTGGCGCGCACGGTGCAAGGCATGATGCTCTATGAAGACGCGATCAAAATCCTGCACTGGCTCGAGATTGGGTCGT
CCCCGAACCGCACGCCCGAGCAAAAACAACAGCAATTGGAAGATATGATCCGACTCAAATTTTCCTACGTATGTGCGTGTCAAGTGTATGGGAAGCACCG
CGCGGAAAATGCCGACCAAGCGAACGATATTGACTTTTTGCTCCAAACGTATCCGAATTTGCGCGTGGCGTACGTGGACACAATTCCGGGCGCGAACGGC
GCGCCGAATCGATACGAAACAGTCTTGATCAAGTCGGAAGGCGACGAGATTGCCGAGGTGTATCGGTGGGAGCTGCCTGGTGATCCGATTTTGGGCGAGG
GCAAGCCGGAAAACCAAAACAATGCGCTCCCGTTTACGCGCGGCGAATACGTTCAAACGATCGACATGAACCAACAACATTACTTTGAAGAGTGCTTGAA
GATGCCACAGCTCCTCGTGACGGCCGATCAACATCCGAGTAGACTGCCTGTGACGATCATTGGGATGCGCGAGCATATTTTCACGGGCAATGCGTCGTCG
CTGGCCAAGTTCAAGACGTGGCAGGAGCTCGTGTTTGTGACTCTGAGTCAGCGCGTGCTGGCGAATCCGTTGTATGTGCGCATGCATTACGGCCATCCCG
ATATCTTTGACAAGGTGATGGTGCTCACGCGCGGTGGGGTGTCGAAAGCGTCGAAGGGCATCAACTTGAGTGAAGACGTGTTTGCCGGGTTCAACTCGAC
GTTGCGTGGCGGCGTCGTCACCCACGTCGAGTTTATGCAGTGCGGGAAGGGCCGCGATGTCGCGATGTCGCAAATTTCGATGTTTGAGGGCAAGTTGGCG
AACGGCGCCGGCGAGACGTCGCTGGCCCGCGAAGCGTACCGCATGGGCGCCTTTATGGACTTTTTCCGCCTCAAGTCGATGTACTATTCGCACACGGGGT
TTTACTTTGCCACGTGGCTCACGATTGTGACGTCGTACGTGTACATTTACGCCAAGGTGTACTTGGCGCTCTCGGGAGTTCAAGTGCAAGTGGTCGAAAA
GATGAACTCGACCCAAGTCATTTCGCTCAATGCGTACCAGCACGGCTTTGACACGCGTGTGTACAACGATCTGGACAGCGTCATGAACACGCAGTACATT
ATCCAGGCCGGTCTGTTTTTGACGCTGCCGCTGATTGTCGTGTACTTTGCGGAACTGGGCTTGATTGGGGGTGTGACGAAGCTCCTGAACATGATTTTGA
CTGCCGGTCCAGCTTTTTTCGTGTTTCAAGTCGGCACGACGATGCACTACTTTGACAACAACATCATGCACGGCAATGCCAAGTACCAAGCAACGGGTCG
TGGGTTCAAGATCACGCGGGAGACGTTTGTGTTGCTGTACAAGGCATATTCGACGTCGCATTACCGCAAAGCGTGGGAGTTGGTTGGGCTGTGCATGCTC
TACTTGTCGTATGGCAGCTTCAACATTTGCAACCGCACGCCCGACCCGAACCGTCCGGACGACCAGTTTGCATCCAAGTTTTGCGACACTGCGCAGGGGT
ACGGCACGCAAACGTTTGCCATTTGGTCGATTGCGATTCTGTGGCTGTTGTCGCCGTTCATTTTCAACGCGGACGGGTTGGACTATGAAAAGACCAAGGC
CGACATTGTGGCGTGGTGCAAGTGGATGTTTATGGACGAAAAGGCGACCGACCCCGACAAGGTGCACACTGGTGGGTGGATTGCGTGGTGGAAGAGTGAC
CAAGAACAGTTCTACGCCACAACAGGCATCGCGCGCCTCACGGTACTCTTGCGCGAATCTCGCCATTTCCTGATCATGTGGTACGTTATCACTCTCCGTC
TCGAAGCCAAGTATGTGCTCTTCACGCTGGCGGCGGCGGTGGCGACCTTGGTGGTGCTGTATGTATTCCACGTGCTGGGGCTAGCGCTGCGCAAGGCGGC
GTTTTTGGGTCGTGCCGCGCTGTACCTGTTTTTGCTCTTGCTTTTTGTCGCGGGCAGCTTTGTCGCGATGAATCTGGTCCTGTTCAAGTCAAAGAAGAGC
GACGAGGCGTGGGACAATAGCTTGTGTTTGTTTTACGGGTACTGCGCCGCCTTGTACGGGATCAACGAGATGCTTCGCGTGGCCAACTTTAAGGGCATGC
CTGTGCACAACGTAGCGGTGGTCGCGCAACTGGCGTTCTTTTTCGACTTCATCTTTGGCGCGTTGCTGCTGCTACCGCTGCTTGTGCTCAGTTGCATCCC
GTTCATGAACGCGATCCAAACGCGCATGATGTTCAATGAAGGGTTTTCGAAAGCGGTGTCTGCGTCGTCGCAACATGCATTTTCCCTCGCCGCGGCCCTC
GGTGCGTTGGTCGGAGTCGCCTCGGGCTGGCTCTACTACATGCTCTTGTCGGTGGACTTGGCTCCTGGCTACAGCATTTACCTGACAACGTACAAGCTGA
CGTCGGTGGTGGCCGGAAAAGGCTTGACGTCGTACATTGCGTTGGCTGGATCGGTGGTTGGGTCGATCCTGACTAGCTTTATGGGCTACGCCTTGGGTCA
CCGCATGACGGTGCTCATTGCAGGTGTGCTGAGCGTGTTGGGCTGCTTGGCGCTGAGTTTTATTCCGTCGTTGGCCCCCAAGACTGGGTCGCAGTCGCCG
GCCGTGTTGTTTGGTGGCATTGGGCTCTTGTCTGTGTCGTTGGGCATGATGCTGCCTGCCGTGTCGTGCTATATTTACGAAATCTCGACCTACGACATGC
GCTCCAAGACGATGCTGCCGTTTGCGTTTGCCTTTGTCGTGGGCACGGCCATCTCGTCGTATTATTCTGGTGGTGCTGTCGGTTGGGTGTGGCAATCATT
TTGGTGCGCGCTGCTCATGGCGCTTGTCACGCCGCTGATGAACATGTTTCCCGAATCGCCACAATGGGTGCTCGAGCGCAAGGGCTATGAAGAGTGCGAG
ACTGCGCTCAGCATTTTACGTCAACGCCCGGAAAATGCCGCCGAACTGCGCGAACTCCGCGAAGACCAAGCCCACGCAAAGAAGGACAATGACGGTGGGT
CGTCGGCGTACAAGGTGGCGCTGTCGATGTTGTGCATGATCATTTCGTCGCTGTCGGTGGGATCGCTCAATGTGTTTGTCGCGCGCACATTTACGACCTT
TGCCGACGACAACTTGGTCTTTACAAACGCATTGGTGGTGGAAGCGTCTGGCGTGCTCGTGAGTTTTTTCCTCATGGACAAGTGGCCCCACCGCAACCTA
CTCGCGTTTACGCTGCTCGGCGTCGGGCTGTGCGCCGGCGCGCTCGGCGCCGACGACGTGTCTCCGTTTTTGGAAACCAACAAGAACCGCAAGCTCATCA
CGTCGTTGTTTATGTACGTGATGTTCTTCATCAAGGGCCTCGGCATCTCGTCGACGGTGTGGGTGAACGTGACGGGTTTGTTTGCGGCCAAGTCGCGATT
CTTTGCCGTGCCGCTGTTGTTTGGTCTGTGGTTTGCCGTCCCTGCCGGCAGCGTCGCCCTTCGCGTGTCGAGTTTTACCAAGAACGCGTACTTGTGGTTG
TTTGCGTTGGCAGGGCTGTGCTTGATCACGCTGTTTTTGGTCGTGATGGCGTCGAACCGCGCCAACGGACTCGTTTGCACACGCACCGACATGAAGAAGG
ACAAAGCGCGTCGCGACCGGCTGCGAGGGTCGCGGCACTCGCGCACCCCCGGCAGCTTTAGCCGCAACCGCCGTCAATCGCGGTCGGCGCGCCAGTCGCG
GTCCAACTCGATGGCGAAATCGTTTCAAGGCAGCTATCAGTTGGTCGCGTCGCCCAGCGCCAATGCGCACGTTGTGTAAGACTAGATCTTTGAACCCGCC
CTGCATACTCTCAATCCAATTTGCTATTTTACACGTGGGGAATTCTTGCACGAAGGGGGCGAGGGACGAAATTTCGACGACG