Transcript Name :
Aphin_H310_08863
Orientation:
(-)
Number of Exons:
1
Description :
glycylpeptide Ntetradecanoyltransferase 2 putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-444
NN-scoreoddsWeighted Score
0.6011.5240.003
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
Cluster Id
761
Sequence
        1335 bases(100 bases per row)
ATGTCGTCGAAGCAGGAAGAAGATGCCCACGTGGAGGAAGTGGAGCTCGAGAGGAAGGACGGAGACAAGTCCGCCGCGGAGCTCGTGACTGTCGAGGAGC
AGGAAGAGTTTCTACGTGTGCTGAAACAGCTCAACTTGGTGTCGGCCCCGCCTCCGGCCGCACGAACAAAGGCCGAGTCGGACTACAAATTCTGGAAAAC
CCAGCCCGTGCCGGGCATTTCGGAAAACCCGGTGGACCACGCCCCCATCGACAGCCCCAAGACAGTTGATGATGTTCGTGCGACGCCGCTCAAGCTTCCT
GCTGGCTTTGCATGGTGCGACTTGGACATGACGGACGCTGGCGACGCCAAGGAACTGTACGATTTGCTGTACCAAAACTACGTCGAGGACGACGACAACA
TGTTTCGGTTCGACTACTCGATTGAGTTCCTCAAGTGGGTGCTCACATCCCCAGGGTATCACAAGTCGTGGCACGTCGGTGTGCGCAACGAAAAGACTGG
CAAACTCATGGCGTTCATCAGCGGCATCCCGACCAAGATCAAGGTGTACGACCACACGATGCCCATGGCGGAAATCAACTACCTGTGCGTGCACAAGAAG
CTCCGAACGAAGCGACTGGCACCAGTGCTCATCAAGGAGATTACTCGTCGTGTCAACCTTCTCGACGTGTGGCAGGCAGTGTACACGGCAGGCGTCGTGC
TCCCGATGCCCGTCTCGACCTGCCGATACTACCATCGCAACTTGAACCCGAAAAAGTGCATTGAAGTCGGGTTTTCCCACCTCCCGCCCAACATGACGAT
GACGCGCACGATCAAAATGTACAAGGTGCCCGAAGAGCCGACGCTGGCCAACTTTATCCCGATGCAGCCCAAGCACGTGTCTTGCGTGACCGGGCTCCTC
CGTCGGTACCAAAAGAAGTTTCACTTGAAGGCCGACATGAACGAGCACGAAGTCGCGCACTGGCTGCTGCCGCGCGACGGCGTCGTGAATACGTACGTCG
TCGAGAACTCAGAGTCGCACAAGGTGACCGACTTTTGTTCGTTCTACCACTTGCCGAGCACGATCATTGGGAATGCGACGCACAAGACGCTGTTCGCTGC
GTACTCGTTCTACAACGTTGCGACGTCCGTGTCGTTAACGGACCTCATGCAGAACTGCCTCATCATGGCCAAGGCCGCCAACATGGACGTGTTCAACGCG
CTCAACTTGATGGAAAATTCCGAGTTTTTGGACGAACTCAAGTTTGGCATGGGCAGCGGCGAACTTCAGTACTACCTGTACAACTGGCGCTGCCCCCGCA
TGCCCCACGACAAAGTCGGCCTCGTATTGCAGTAG