Transcript Name :
Aphin_H310_14836
Orientation:
(+)
Number of Exons:
13
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Src homology-3 domain9.4PR00452
Src homology-3 domain9.4PR00452
Src homology-3 domain9.4PR00452
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain14.714PS50294
WD40 repeat10.208PS50082
Src homology-3 domain15.333PS50002
HmmSmart predictionP-Valprediction_id
WD40 repeat0.097SM00320
WD40 repeat0.5SM00320
WD40 repeat2.4SM00320
WD40 repeat1.3SM00320
WD40 repeat160SM00320
WD40 repeat1.3SM00320
WD40 repeat3.5SM00320
WD40 repeat0.062SM00320
WD40 repeat23SM00320
Src homology-3 domain2SM00326
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1155
*** None ***
*** None ***
TypeScore
cytoplasmic478
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        4241 bases(100 bases per row)
TGTAACTGACTGGGACCAATAGGAGTAACTGCTTCGGTCCCGCTGATCTCGAGCGACGGCGAGGCGGTCGCATGAACGAAGACACGAATGACCAATGTAA
GGCAAGGTCAAACAGCTCAAGTGTATTTAGCGGTGTTGTCATTAGTGGCGTCTTTCATCACGACTCTCGTCCAGAAGGAGCTTGACGTGCTGTTCAAGTC
TCGGGATGAGAACATCGAGCGGCTGAACCAACAGGTGACAGCGCTAATCAAGGATGTCGAGCGCATCACGATGGAACTGGAGTCTCGAAGTGCATGGAAT
CGAAGCTTAACCAAATACGAGGCTCAACTGAAACTAGCTGCCCAGGACACGTCCCCATCCAAGAAGTAAGTTATCGTACCCCGAACGCCATGGCACATTG
ACATTGCTTTGGCAGGAAATTCGCTCAGAAATCATGCAAGAGATTGCCAGCGATTGATCCCGCCGATGACGACACAACAAACGTACGCAACGAAGACGGG
AAGCTCGTGTTTGGTACGTCCTGCGAAGCGAAACCCGTTCTCAACATGCTCTGCTGCAGACAAAAAGTTGCCACGCGTGGCCAACATCGACAAGAGCAAC
CAGTCGTTCTTGAACGCCCTGACGTTGCAATCGCAAAAGCAAAAGATCTACGAGCAAGCGTTCGTGCGGTACCCTGAGTGCAGGAGCACAGTGTTTGCGC
CAAGTAGCTGGGACCCGCGCAACATATCTGTCCAACAGCTCGAGCTGCCGAATATGCAACTCAAGCTGACGCGAGTGCATGGGTACCACAGCACATCCAA
CTCGAATGTGTTTTACTTGGCATCGGGGGAGCTGGCCTGGTTCACGGCCAAAGTTGTCGTCATGTACTCCAAGTCGAGGCAGCTTCAGCGGTTCTACATG
GGCCACTCCAAGGAAGTGACTGCAATGGCGATGCACCCAAACGCGCAAATCGTTGCGTCGGGGCAGTGCGGCAAGGACTCTGCGCTGATCCTTGTGTGGG
ACAGCAAGCGAGTGAACGCGGAACCGACTCATGCATTGGCAAAGCTCGAGGGACAATCCGTCAACATTCGAAGTTTGAGTTTCTCACACGATGGAAAGTT
GATCGCGTCGTTGGGAGGCGACTTGTACAATACCATTTGCGTGCACGACTGGCAGGACCAGACGCTTCTGGTAAAGGCCAGGTGAGTGCGTTCAAAAACG
AGCCTAGACAGCTCAAGGCCTGGAGAGTTGTAGGGGCCACAGCTCCAAGGTTTGGACCGTGGCATTCAATCCGTACCAGGCGTACGGAATGCCCGACAAA
ACCAAAGCGCAGCAGCGGGTGCCCAAGAGGCAAAAGTGGGAGGCGCGGCCCCGCCCTGGCCAGGCTCTTCGAGATGAAGATGCGTGCTACACTCTTGTAT
GTCCACGTCGTCGCAGGCTGCATTTTAAACGTGTCGTAGGTCAGCTGCGGCGTTCAGCACATCAAGTTCTGGACGCTGACCCAAGTGGACTATTCGCCTC
CGACTACTGTGGCCAAGGTGGGGTGAACATAGATTATTCATCTCAGCCCGGCCTGAAGGAGGAGAGCGCATTCTATGGGTCGTGCTTTGGCGGGCCGAAC
CGCGCTAGGCAGCCCCTGCCCCACGAGAAAGTGTGGAAACTAGAAGGCAACCCTCCGCTGATGAAGAGCGAGGCCCAAGACTTCACGTGTCTTGCATTCA
CCGACGATAACGTTCCTCTGCAAGTGTACGACGAAGCCACCGACTGTATAGTCGAGTCCCCGACGGTAACAAGTTTGCCAAGCCCTACGGAGCATTCATC
ACCCCCCTCACAGCAAAGCGAAACCACGCTGGGTCGCATTGTCGCCGGTACTGCCAAGGGCGACCTGTACGTATTCTGGCAACCTCGGAGGTCTCCAAGC
CCGCAACAACCTGACTTGCCTCAGAAGTGGTGGGAGCTCCCTGCTGCGTCGTGGCAGCTGAGCGACGACGTATGTCTCGAGCATGTCCACTTCGAATCGA
CAGCGAAGCTCGTGGAAATTATCCCGCACGACGTATCGACTGGAAACCGGTTCAAAATCTCTCGCCATGCTCAAATGGAGTTGCAAGACCTCCAACAAAG
GTGATTTGTACACGGATGAGGTCGTGGCTGTGACCTGGAGACGTAGACTGGCACTAAAACCTGATGCCAAGCCGTTGCTCGATCGTCTCGCCAGCCTGGA
ATACAAAGGCCCCCTGGCTCACGTGAACGGACCGTGCAGCCAAATCGCGTGCGATGTCAGATCGGGCAATATTGCGACTGCTGGTGGTGACGGCAAGGTG
CACATTTGGACTCTGCACCTCTTGGACCCGATGAGAGTATGTGGGACTCGAACGCTGGGCCAGTACACCCCCATGCATGGCGCAGCCAGCGACGGGCGAC
ACAAGATGCAGCTCGAGCGAAGTATTCAAATTCCGTCCAAGGCTCGGCTGACAAGTCTCCACTGGAGTGGCGATGGAGCGGTCGTGGCTGGTCTGAGCAA
CCACAGCATTTGGGAAGTGGATGTTGCGACGGGTGAATGGAGTGTGGTGGTCGAAGGGTGCGAGGGCAGCGTGTTAGGTACGTCATGGAGAGTGCACGGG
GAAGACTCAACTCGATCGACGAACAGGGGGGGTGCTTTTGGAGGACCAGAACGAGCTCGTGACGGTGTCAAGCGATCACTTCATCCGGTGCTGGGACATG
GGCAGCCTCCTGTGCGTGAAGAAGTGGCCACTTAAGAGCACAGGTACATACATCGAAGCCCATCCAAGTCGCGGCGACCTTGCCGTGGGGTGCGCAGGGG
GAGAGGTACGGCGCACTCTTCACCCTTCAAGGCACATGGGTTGTTGCCGTAGGTGGTAGTGCTCAGCTACCCCGAACTCTCGGAGAAGAAGGCGCTTCGA
GTGCTGAGCAACGAGAGCGTAAGTGTGCTCAAGTTTAGCCCCGACGGCAAGTACTTGGCCGTGGGTGCCAAGGACAACTGTATGCACGTCTACGATGCGA
CCGAGAGCTACAAGAAGGTGGCCAAGTGCGAGGGACACGCCACGTTCGTATCGCACATCGACTGGAGCATCGACGGGTACTTGCTGCAGACCAACTCGGC
CGACGGCGAGATCTTGTACTGGCAAGTCCACGGCGCGTCCGTCCGCCAGATTACTGACGGCATGCTGGTACGTGTTGGTTCTGCAACGAGAGCAGCTGAC
GCAAGTTGCAGATGCGCGATATTTTGTGGGACCGGTGGAGTTGCGTGTTTGGATGGCCTGTGCAAGGTATTTGGGCAGACCACAGCGCGTGCAACGATGT
GTCGGCGGTTTGCCTCGTGGACGTCGTTCCAACGTACAACCACCGACCTGCAGATGTGCACAACGTACTGGTTGCCGATCGCAGCCATCTTCGCGCATTC
CGTTGGCCATGCATGAAGTCTGCGCAAAGCTACAACTACGATGGACATGCTGCCAACATTACATGCATCCTGACGTGGAAGCAGCACTATGTCGTCACCC
TGGGTGGAGCCGACGGAACGATCATGGAGGTACGGAAGATGGTTTGAAAGGCTCGGTCCAACCGCGTGATGTGTAGTGGATGGCTGTCGCGAACGAACAT
AGGGAAGTCGACTCTATGCAGGAAGGGCGAGGCTGGAATGGCGAGGTCGATGCGATGGAGCAGCAATACACAAGCAGGCCGATGGACAATGATGGAATTC
CTGTGGACCAGCCATCCAGCCCGACACGGCCACCATCAGACAACATCCAACGACCAAGAACACCACGACACACTTTCATCAAGGAGGGTGCAAATGATGT
GACCCACCAGAGCGAGGAAAGCGTCCCAGATACCGAGCGAAACACTGACGACGTGGAAGTGCGTGTGCCGCGGGACGAGATTCCTGCAAAGGAAGAGGCC
ATTCGTGAAGGAAGCACGACAGATGGCATCGAGTGTGGCCGCGCAAAGTTTTCATTTCAGGGCGAACACCCCGACGAGCTCAACTTGAAGGAGGGAGAAG
TTATTCGTATCTTGGAGAAGCGAGAAGGCGACTGGTGGTTTGGTGAGACTTGCGACGGAACGAGTGGCATCTTCCCACGGGAGTATGTGCAGATGGATTA
GCAGACATCAGGGTGTCCAATCCATCCATGATGCAACCCCGTCGTCCCATGTCTCTGCTTGTCGCGGGAAAGTTCCTTTGGTGTGGTGGGATTCAGACAT
CCGAAAATATTATCTTGCATGAATATAACAAACGTTCCGAA