Transcript Name :
Aphin_H310_13541
Orientation:
(-)
Number of Exons:
1
Description :
zinc-finger containing protein, partial
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, A20-type8.99PS51036
Zinc finger, AN1-type11.306PS51039
HmmSmart predictionP-Valprediction_id
Zinc finger, A20-type7.7SM00259
Zinc finger, AN1-type7.7SM00154
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-161
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA bindingGO:0003677IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        569 bases(100 bases per row)
ATGCAGCAGCAAAGCGATAGTTGCGACGCCCCTCGGTGTACCGGTGGGTGCGGATTCTTTGGCAACGCGGCATGCCATGGCATGTGCTCTGTGTGCTGGA
AGAAGAGCGGTACCAAAGCTCCGTCGAGCGCGCCGTCCCCGCCTGCGACTGATCAAGTGATCGAGCCAGATACCGTCGTCATAGCAACAGGAACGACCAC
GGGCGACACGATGGTGGAGACAACGACTGCGGAGGCAGGAACATCATCGACGAACGACGAAGCTCCTCCCGAGAAACCAGTGCAGACAAACAAGTCCAGG
TGCTGGGAATGCAAAAAAAAGATCGGCCTTACAGGAATCGAGTGTCGGTGCGGCTTCGTGTATTGCGGGATACATCGGTACGCTGACCAGCACGAGTGTA
CGTTCGACCACAAGGCCGCCGATATCGCTGAGCTTGCCAAGCGCAATCCTGGCGGGGGGCACTTCAACAAGGTGGAGAAACTCTAGATTACGAACAACCA
TCATCTCTAAATCCACGCCGCAACCATGAAAAACGAGTACTTCATAATTTGTACTAGAAAACAGAGGCA