Transcript Name :
Aphin_H310_05270
Orientation:
(+)
Number of Exons:
4
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5760.61925
InsideOutsideTMhelix
1-164
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        660 bases(100 bases per row)
ATGCAACACGTGGCACTTGTGGCGCTTGCCGTCTGCGTCGGCGCAGCGGTGGAATTCCGATTCACAAATGCTTGTCCTGTCAACGTGCTAGTGCAAATGG
ACGAGGGCCGCGTGATTTGCCGCCTCGGGCCAAATGGGTCCACGTCCAGCATGTGCCGCGCCACCGCGACTGCAGCCCAAGGCTCGTTTCGTGTCGTTGG
AGACGTGTTGAGTACGTGGGGTGTCGTCGACGTTGCATGGAGAGGCCGCCATGCGTTCGTGTAGGTCTGGCGTATGCGCAGGACATGCCCCGTGATGCAT
GGTGGCAAGTTCGGTTTGAATTCCACGCTGGACCAGGTACAAGCACGAAGTCCCATCATAGGCACTGAACGTGTTGTGGGGTCGTCAAGGCACTCCAACG
ACCGTCGCGCCCGTGGCATTCCAACACGGGCCTTTGACTTGCCAGCCACTGTCGTCCACCGACTCGACCCGGCGGCCGACGCGGCACTGCCCGCTGAGCG
TAGTGCTCAACGTGACGTATTGTTTGCCGACGACAGTGCCAACTCATGGTGGCCGCAGTACGGCCGAGTCCACGTCCGATCGTGCTCGCGGTTCAGTCAG
CCCAGCTCGCCCCGATCCAGTCGCCAACCCGACAAACCAAGACAGTCGCACTCGTCGTAA