Transcript Name :
Aphin_H310_13913
Orientation:
(-)
Number of Exons:
1
Description :
PREDICTED: uncharacterized protein LOC101736207
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-471
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1416 bases(100 bases per row)
ATGGACCCGGCGACAATAGCCCAAATCAAAGCCTTAGTAGAGCTGCGCCGCAGGCGCAGCTTGACTATGGATGAGAAGATGGACATACTGTGGCTTCAAG
CCACACTCCGTGAAGAACGGAGAAGCGACGTTACTGGTACCATCTCTCGCTTACTTTTACGCTCCAACAAAACCGTAAAGGGAGTCCTTTGCGAGTTCCT
CGGTAGGGGCAGTTTGTTTGAGGCCGACCCACCTTTGAACACGAAGAACCATCCGTCGCGCGTTCCTACGTCAGCCTCGGTCCGTTCTCTTGTGAGGACG
TTTATTCGAGACCGCTGGGTCACCCGTACCAGGACTGTCGCCTGGGACGTCTTGGCGCTCCTCATTGACCACAACGTCGTCTTCGTGGGTGCCACCCGGC
CAAATGACTACTCCGCTGGTTTTCGTGCTGTCCAAGTCTTCTTGTCGAATGAGGGGTACGCTCGTGGGAAGCGCGCGGGGAGAACTGAGTTCAGGATGAC
CAAGGCGGATGAGATGGCATGGGACGCTTACTTCAGCATGATGGTGCCAACAGGGGTAATGCGTCCTCGACGACCCGTGGTGCACCTTGACGAAAGTTTC
ATTCAACATCACTACACTCGTCATGAGGACAGTCTGTACGACCCCGAGCACAGCACAACGAGGCCAAAATACAAAGGACGCCGATTTTGCCTTATCGCTG
GAATCATTGATGAGGGACTGGACATTTTTGTTGGTGGAAAGAAGAACGGGAAGACAGTGAAAGACTACCATTCAATGTTCAACCATGCATACTTTGTCGA
CTGGTTTGAGAAGCTGCTCGATGAAGTTGAGAACCTTGGATGGGCATCGGCAGTCTTTGTCATGGACAACCCCAAATATCACAAGGGGCGGCCGTTCGAC
ACTCCCAAGGGCAATTGGAAGAAGGACGATCTCTATCAAGAATGTGTGAAGTTCAAGGTTCTTGGTGCGTCTTCTACTGATCTCAAGGCGATGATCTGGG
CAGCCTTGAAGAAGCATATCGAGGAGCACATCCCACCTGTCGTTGTCGAAATGGCACGGACTCGTGGACATCATGTGGTGTTCTCGGCTCCAGGGTTTTC
TGACCTACAACCGATTGAGATGGTGTGGGCCAATGTGAAGGGCACAGTTGGTCGAGCTTACACTTCTACATGTACTACTACGTTTGCGGGGGTCCGCGAT
CGTCTTGATCGGGTGTTTTATGAATTGGACACTAAGGTAATTTACAGTGCAGCATTTACGGCAAAACTGCTTATGCTGGATAGCTCTCTTCGAGAGGCAG
AAACTTTGGCGGAAGCAAGCTGTTTTAAAGACTTCGATAGCGAAACTTCTAGTGAAGATGACTTGTCGGCTTCAAGCGACTGCGTCGGCATGGGTGTGAG
TGAGAATGACGAATAG