Transcript Name :
Aphin_H310_13911
Orientation:
(-)
Number of Exons:
6
Description :
dynein light chain
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pleckstrin homology domain9.647PS50003
HmmSmart predictionP-Valprediction_id
Pleckstrin homology domain1.4SM00233
Pleckstrin homology domain0.018SM00233
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
*** None ***
InsideOutsideTMhelix
1-369
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4918
Sequence
        1599 bases(100 bases per row)
GGATGTGTCACACACAACATGACGTCGCTCCTGCGGAATCGGTCGACCAAGGAGCAATCAGCGACATCGACTGCGTCGGCGAATGCGCCCAAGGCAAGTT
CGATTCCACTTAGGTGACGTAATCTGACGGGATTTGGGTAGATTGTGCTCAGCGGGTGGATGCGGAAGCAGAAAGCCCACTTGAAGACATGGAATCGGCG
GTACGGATCATGATCACGCCGCCTTGGTCGTGGACACGGCGCTAATGCGAGACGTCCCGCATAGATTTTTCGCCCTCTCTGGAAGCACGTTGTCATATTA
TGATAGCGAGGACATCTCGGGGGCGCCCCGTGGGATCCTCGAAGTGGCGTCGGTGCATCCGCTGCCTTCCGAACCAAATGGACTTCTGTTACACTGCAAA
GCCAACAACAGCACAAGACGGCGAGATGAAAAGCTCATTTGCGACACCAACGTTGCGTACAACGCATGGTTTGCGCTTCTGACGCGCGCCACGACAGCGG
AAACGCTAGAACCACTCAGCCAGCAGCCATCGTCGGCTTCCATGGTAGCATCGGCGATCGAGGGAGTTCATCTCATCTACGTATTAGATGCCTGCTTCTT
CATCGCCGGCTATGGACTCGTCGTCAAACGTGTCTAGCAACAATTCGGACGCGTCGATCCATCCAAGCTCCCCCGTCGCGTATCGTCCAAACCCCATCAA
GATGGGTTACGTCCATGTGCACTACGCCGCGTCGTCGTCTGGTTCGGCGCACAACCTGACCAGCAACCAAGAACATGGCGATGGCGTCCCCGCTGCAGAC
GCGGATGCGTGGAACCGATATTTTATAAAAGTCGAAGGCGATCTGCTCAACTGTTACGCGGACGAGTCCCAGCAGCATCTCTACGTCAGTGGCATGGTAC
GCGTCTACACTCGGTCGTCGCCGTGCTTTCATTGAAGCGTTTGTGTTACGGTGCAAACGTATGTGGAAGTGGTGGATGTCGGCGGGTTTCTCGCAACATA
CTTGGTGCATGATGCACGTTCGCAATTCCTTTTTGCACGATGAACGGAATACCAGAGATGGTCTCATTCTTGTGTAGGTGCGCAATGTGACGCTGTACGA
AGGGCGAAAGTACGCTTTGGCCGTTGGCCTCAACAAAGGCCGCAAAGTCGTCTTGTGTTGCGACAGCATGGAGGAAAAGACGAATTGGCTGCTTACGTTA
GAGGGCGCGTTGAAAATCGCGTATAGCGTGATCCAGCTCCAGCGCCGTGGAAGTGCCGGCTTGAAGCGTGCATCAAGGTACGCTCCCGTCAAACTCGACT
TGCTGTTCACGTCACGCGTGTAGTCACATTTACGACCTGGACTTGTCACCAGAGGATCAAGTAACGCCGGCGGTATTGACCGGTCTAGAGGAAGAGAACA
AACTGCGCGGTGTACAGGAACACACTGACGAAGGAGACGAAGGCGACGACCATGTGGCCGCCTCGGCCGTGACGGAAGATGGGTCTGAAGCGAGCGGTGT
GTGGATTTGACGCGTCGGTCTCACAGAAATAATGTAGACGTAATTGATTTTTGTGGATTGGCGAATGAAATTGAAGGAGTAAACTCATTTCTACCAATG