Transcript Name :
Aphin_H310_13916
Orientation:
(-)
Number of Exons:
1
Description :
Phospho-N-acetylmuramoyl-pentapeptide-transferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-151
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K02955
*** None ***
Sequence
        690 bases(100 bases per row)
CGCGGATCCATTGGTTGTCCCGGCGCTGGCCACGGGGGCGGTGGCCCATTCCTTCATTTGACGGCCTCCATCCCCCACTTGAAGAATATGTCGAAGAAGA
CGAAGGCTGTGGAAACCGTGACGGAAGTCGTCAAGCTCGGACCCACCAACCGCGAGGGGGAAGAAGTCTTTGGTGTGGCGCACATCTTTGCCTCGTTCAA
CGACACGTTTGTGCACGTGACCGACTTGTCGGGCCGTGAAACGATTGTGCGTGTCACTGGTGGCATGAAGGTCAAGGCCGATCGTGATGAAGCGTCGCCT
TACGCTGCCATGTTGGCCGCCCAAGACGTCGCTGCCAAGTGCAAGGACGTCGGTGTCACCGCGTTGCACGTCAAGATCCGTGCCACCGGCGGTAACCGCA
CCAAGACCCCCGGCCCTGGTGCCCAATCTGCCTTGCGCGCGCTTGCCCGTAACGGCCTCAAGATTGGCCGCATTGAAGATGCTACGCCCATCCCCACGGA
CAGCACTCGCCGAAAGGGTGGTCGCCGCGGTCGCCGCCTCTAAGCGCATGGCGGGGACTTGCCTTTCTCGCCTTGCTCTCGGCTCCTTCGGCTCTGCTCT
TCGGGCTCTGGCTACAAGATGGTAGTTGGAATCCGTTCGACACAAGTATCAACGCAATCAATAAATCTGTGTTGGTCCAATATCGCTCGC