Transcript Name :
Aphin_H310_13902
Orientation:
(+)
Number of Exons:
2
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Acyl carrier protein-like12.611PS50075
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Acyl carrier protein-likeIPR009081
*** None ***
InsideOutsideTMhelix
1-663
NN-scoreoddsWeighted Score
0.6812.2280.004
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        2020 bases(100 bases per row)
ATGGTCATGTTTCCACTTCACGAATTCTGCGCAAGTGGCCCTGACATGCAACCTAATGCACCTTCCATTGAGGCAAACTCGCGCCCCTGGCGAACGGACC
AGTCCAACGAGCACGCAGCTTTAATTCATTTTGGGGGTCAGGGGAGCGACTACCTCGACCAACTTACCCACCTCGTGACATCGTTTCAGACTGTCCGTAA
CCTCGTGGGTCAGGCCCAAGCAATCTTTGAACAAATCGACGTGACCAAGCATACCCGAATTGAGCCACTGCTGTGGGCGACAGAGCCAGCGTCGCGGCCG
TCCCGATCAGCGCTGCTCCATGCATGTGTGAGCTACCCCCTTGTCTTCTTGACGCAGCTGGCTACGTACATGGCTTTCCTCGAATCAATGGAGGTCACTC
ACGATGAGCTCCTTCCACGCATTCGCGGCGGAACCGGCCATAGCCAAGGCGTTGTCGCAGCAGTGCTGGTCGCAACAGCTACGACGCATAGCGACCTCGA
AGACCTTGGATTGCAGTTCATGCAACTGATGTATCACCACGGTTGCCGCGCCCAAGCCGCGTTTGACTCCGTCGAGGAGGGCCACCGTGCGAATAAAGTG
GGAAACGTCGTGCCTACCCCGATGCTTCTCATCCGCGGGTGGACCGAATCCACACTCTCGTCATTTGTGTTCGATTTCAACGATCACACCATGAACTACC
ACGCCCCAGTTCAGATATCTCTTGTGAACGACGCGACCTCGATTGCCGTGACGGGCCACCCGATGGCTTTGCAGCGCTTGCATGCAGCGCTGGAAGGCAA
AGTGCACAGCCACCACCCAATTGACTCTTTTCGCTTGGAGTTTTTACCAGTGTCGTGTCCGTTTCACAACGAAATGCTCAGTGATGCCCAGAGCGCTATT
GAAGCTGACGCGACTCGGCTGGGTCTTGTCATCCCTGGAAATGCTTTGCACTTCCCCGTCATTGGAACAACCAGCGACGCCACCGACTTGAAAACGTATC
GAAGCCGAGATATCATCCCCGACTTGATCCGCATGCAGCTTTCGGAGACCATCGACTGGCCGGCCGTGTCCGTCACCCTGCAATCCAAGATTGGCAAAGA
GAAGTGCAACGTTTTCGACTTTGGTCCTGGACGCAGCACGCCCCTAGTGTTGTACCCTCGCCGTCCATCCATTCAAGTGAGCGATTGGCTGCACAGAACA
AAAGCTGAACGAGCCCCAATGTCCCCTCGGGAAGCTCAAGTCGCGGCAATATGGGCGGCTCTATTGACCGTCGATGAAGCCGATATTGGTCGAAAAACGT
CGTTCTTCGCACTTGGTGGTGACTCTGTTATCGCATTTCAAGCCGTCGCGGCGTGCAGAGCCATCGACGTCAACTTGACCGTGACGCAGTTCTTACGCGA
TCCAACTGTCAAGGGGGTTGTGAAGGCAGCCAACTCCACCCAGTCAACGGACAAAGTCGTGTGGCCAGAGGCACATGTGGCTCCTTCCTCTTCCGACAAG
GCCAACGACGACTTTACTGTGTACCCGACCACGCCCATCCAAGCAGGAATGGTCACGGCAACTCTGTCCAACGCCAGCGCCTACGTCCTCCAAGTCACGC
TGCGACTCTCCGGCGCATTCAACCAAGAGACTTTGGTGTCTGCGTTTCGCTCACTCGTGGCGGCTAACGAGCTCCTCCAAACGACGTTTGCGGCCACAGA
CTGCGGAATCGTGCAGCTCATCCCCACGGCACGAAAACCTGTGGCCGCCGTAATATCGCATGTGTCTGACGTTGCGTTGCCAGAATTGTTGGAGTCGGAT
TTCGCACGGGGGTTCACTCTGAACGACTCGTCCTTCGTCCGTCTCGCCGTGACGTCCCCTTCAATCATTGACGGTTCGGAGTCTTATGGCGTCATGACCA
TCCACCACGCTCTCATTGACGGATGGTCCATGAATGCGCTCCTGTCGGATTTGCTGGACATCATGGACGGTCAGATTGTTTCGACCCGGCCCGCGTTCCG
AACAGTTGTCGATTACGTGA