/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_a2406200a3bcbdabe4e086070168718f -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/157072 -w 120 -web -o /tmp/images/bd_log_output_file_a2406200a3bcbdabe4e086070168718f
Transcript Name :
Aphin_H310_13905
Orientation:
(+)
Number of Exons:
2
Description :
peptide synthetase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Acyl carrier protein-like14.55PS50075
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Acyl carrier protein-likeIPR009081
*** None ***
InsideOutsideTMhelix
1-505
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1573 bases(100 bases per row)
ATGTCTCACGGCATCGCGTTGACGCCAAACAGTCCCATCACGATTGGGTCAACGATCGCCAATGTGAACTGCTATGTGTTGGACGAGAACCAGCGACAAG
TCCCGATGGGGGTTTCCGGCGAGTTTTACTTGGGCGGCGTGTGCGTGTCGCCGGGATACATCAACTTGCCGGAGCTGACGCGAGATCGATTTGTACTGGA
TCCGTATTCCCGTCGCCCGGGGACGATGTATCGAACAGGAGACGTGGGTCGGTTGTTGCCGAACGGTCAGTTTGAGATCTTGGGGCGGATGGACAGCCAG
GTCAAGTTGAAGGGGTACCGCATCGAGTTGGACGAAGTGGCAAACGCCATGATGCTCCATCCTGATGTCATATCAGCTTGCGTGATCGTCCAAGACAAGT
CCCATCTTGTTGGGTATTTTACTCCAGCCACAGTGAATGTGGAGTCCCTTCGCAAGACTGTGGTCGATCGGTTGCCGGTGTATATGGTTCCTGCGATGTG
GACGGGGTTGGACGAAATGCCCCAGAATTCAAACGGGAAAATCAACACGAAAGCTTTAGCGTTGCTGAAGGCAGTGGTTGAGCTCGAAGCAATGCAGACA
CATGAGGAAGCTAAGTTGGCTCAAGTCATCGCAAGCGTTCTCGAAGTAGACGTGGCAGAGATCGGTCGGCGATCGTCCTTTGTCGCGTTGGGTGGCGACT
CGATCACGGCCATCTACCTCGCTGCGGAGCTTAAGAAGATTGGGTGGAGGGTGTCGGTGGGGGACATTCTCCAGTCCACCCAATTGTGTGATTTGGCACT
CACGGCGACCGAGCAGGCTCATATTCCAGCTGTGGAGTGGTCGGACGTGCCACTTCCAAGCCAAGTGAGCCAGGATATCACGACCGCTTGGCCAGAACAC
GAAGCGGCCTATGCCACGACGCCAGAGCAGTCGTTTTTACTGAGTTCATCGATAGAAAACCCGTCCCGGTGGATTTTGCAGGTGCCATTTGTGGACCTGG
ACGCCAGCAGACTTGTTACTGCGTACGCTCGCATTTCTGAGCATTGCGAAGCTTTGCGCACGACATTCATCCTGGCATCGGACAATACCAACTACCACGT
CGTGAACCCTGCTTCCTGTGTGGAGGTGCGCTGCGAGCACAAGGCGACTTCATTGACCGAGTTCCTGGCGTTGGATAAGGCTCGTGCATTCCAAGCAACC
GATGCAACGTTCGCGCGCTTCACGGTCGTGTCAGTGCCGCACGCAGAATCTATCGGTGTCCTGACCATCCACCACGCGCTGTACGACGGATGGTCCATTT
CCCTTCTCTTGTCCGACTTGATGGATGCTTATCATGACCGTCCAATCCCCCAACGCCCGTCGTTTCGGCCCGTGATCCACTATGTGCAAGCCCAAGACCC
CTCGAAAACAGTCGCGTTTTGGACCGAGTACCTGGCGACTGCCCCAACGTCCCCTTGCTTGACCAACGCAATTGCATCCAAGAAAGCAACGCCAGCTTGT
TCAAGTGACCCTGCGCTGTTCGTTACCGTTGCCCTGTCCCGCCTACTATCCGCCATTCAACCTCTCGGAGTGA