/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_913c5788431df382c98812d5488ed770 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/157072 -w 120 -web -o /tmp/images/bd_log_output_file_913c5788431df382c98812d5488ed770
Transcript Name :
Aphin_H310_13910
Orientation:
(+)
Number of Exons:
10
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
GOLD10.66PS50866
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6410.76625
InsideOutsideTMhelix
1-1
390-396
25-366
2-24
367-389
NN-scoreoddsWeighted Score
0.7642.8290.006
*** None ***
TypeScore
endoplasmic reticulum444
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
transportGO:0006810IEA
*** None ***
Cluster Id
2117
Sequence
        1902 bases(100 bases per row)
ATCCGGATATTTGCTGGTCACCTGAACCACCATATCCGGAACCAACATCCACTCACCCCTATCTTCATCAAGCAAATCCGAACGACCGACGAAATGGTGG
CGGCGCTGCTGTTGCCATGGGTCGGTGTGCTTGCGCTTGTAAGCTGCTTCTCGTCGGTCGGGGCTGGTTCTTCCTTTGCCTTTGACCTTGACGGGAATCA
GGAGGTGGTGTGCTTCATTGCTTCGTGCTGGATCTAACAACGCTTTGCAGGAGTGCTTTCGGGAAGATATTGTGCCCCGGTCGCTACACAGTGACCTGTT
TGTCCATTTTGAGCTGCTCGAGCCACGTCGTCCCACCGATGCGCTGAATGTGAAGGTCGTGTCACCATCGGGTGTGACCATCACAACTTGGACACATGCA
ACTGCCAACCACACGTCGTTGAACGTGCGCGAATCGGGATTGTACTCCCTCTGCTTTACGTCTGCCCGTACGCATTCTCTCATTTGAAAATGAAGGCCTT
ACTTTCCATGTTGTACACAGCTGGCTCGAAAGCGCAGCAACGAGTGTTGTATGTCGTGGACGTCGTGACCTACGGCACACGTTCACTTACGGTTGGCCTT
CCTGCACTCGAAGGTCCATGGCCTAATCGAGGATATCCGCATTAGCGAGACCCCACTGTCATTGCGACGTTGATTCAGCAATTCCCAGACAAACCCAACC
CTTCGACGTTGATGTTGGCGACCGAGCGCGTACTGCATTCAATCCGTCGCAATTCGATTTCACTCGTTGTTCGGTAGGGAGTTCCGGTCTCGATGGGTGT
AGTGGAGTACTCGTTCGCTGGTATATCCGTACATGCACTCCACGAAAACACGAGGTCCGTCTTCGTGTGGCCCTCACTGGCGCTACTCGCTAATGCTGTG
ACTGCAACACGAAGAGTGATTGCTTCGTTTTCAGTGGACTTTGCGTCCAAACCAGGTATTGAAGTCACATTGGCCGCAATCCCTGGCAACCGAGTGGTGC
ATCCCCCCACGTACGTGATCTAGCCTGCCAAGTACTCTCTTGAGTTTCATTTACCAGGTGGACGTCGATGACTACCCACATCGATTCGTTCTACGACCGC
GTTATCACGAATCATGGCGTCTTGGCATCCACTGGCGGCTCGCTCTTCTTTGACATCACCGACACCGTTCGAGGTGGGCTATCGAATTCGACTTTTCGTC
ATAACGTCGGTTCGACCAGCTGCAACTGCGGCACGCGAAACTCTGTCCAAGGAAGCGGAGGTGGACAACGCATCTCCTTCCACCGTGGCATTCACGGTAA
GGCCATCGCTTGGGCATGGATCTACCATGTTGTTGGGGTCACACTGCACGTGCCGGCTAATACATGACAGATTCAAGTTGCGGAAGATGGCGAAGTACGT
CTTGCAGGAGGCGCTCACGCAGGGTCGGATGCATCAGTGCCAGCGTCGTTCGTCATGCAACACCGTCGCCCAACTCTTTCCCTTGAAGACCTTGGATTAC
CTGTCCTTCAATTGATCGGCCGCTTTCGGTATGCTGTGTGGGATCTCAAAGGAGAGTTAGTGTCAATTGTGCAGAACGAGCGGCGCAGTCGAGACGGTAC
GTTCCCTCCCACCTCCATCGCCTCATATGCTTGTCCATCAATCGAATCATGCTCATGTTTCTAGCGGCGGAGAGCGTCTTGGACCGCCTCGTTATCGGCA
CGATCCTCACCAATGCGTTCCTGCTTGGGATTGCCGTGTTGCAAGTGGTGTATGTACGGGGGCTGCTCGGTCGAGGTTAATTGGTGTATTTCCACCAATG
CAAATCGAGAAACCAGAAATACTGCGACTCAATTGGTGGATTCTATCCAGTAAACAAGCAATCGAGAACTAAAAGTTTGAAAATATATCCAATCAAACGT
AG