Transcript Name :
Aphin_H310_13920
Orientation:
(-)
Number of Exons:
1
Description :
golgi apparatus membrane protein TVP15, partial
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-42
90-101
148-198
66-69
122-124
43-65
70-89
102-121
125-147
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        668 bases(100 bases per row)
TATTCGACAGTTCCTTGCCAAGTTCCATGGTGTCGTCGTCGTCCGCTTCGTCCACCTCCATCGCGGGGCCGCCGCCGCCGGGTCCTACCGTTGCGGAGCG
AATTGCAGCTATCCAGAACATGGACATCTCTCGCGTGCTTCGCTTGATGCGAGTGGGCAACGTGTTTTGCTCAGTATTCCAGATCATTGCTGGAATTGGC
GGGGTGTTCGACCTGATTACCCTCAACGTCACCGGCGCCCTCTTGTCGCTGTACGTCGTGCTGTTTGGCTTGCTCTTCCTCCTATTCGAATGCCGCTTGA
AGACGATGGAGAACCGCATCCGTACCAACTTTGGCTTTCTCTTCTCGTACAACGGCCGTGCGGGTTTTATCTTCTTCATCGGTTTCCTCGATTTCGGCAT
GGGATCAGCCATGGGGACTGTTGCCGGCATCCTAATGTGCTTGAACGCGTTCTTCAACCTCTTTGTCATGCTCAAACACCCCGAGTTTGCCTCGGGCGCT
GTCCGCAAAGATGCCGACCCGACTGCAGGGTACGCCGACTCAAAGGAAGCAGCCCAAGCTTACCTCCACTCGAACCCACAAGTCGCCCTTCAAGCTACCA
AGTTTGCACTCTCTAGCAGATAAGCTGTTGACTTCCAATTGAACATATTGCCATGCTTCGTGCTCTAT