Transcript Name :
Aphin_H310_13914
Orientation:
(+)
Number of Exons:
2
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-74
NN-scoreoddsWeighted Score
0.8474.8740.01
*** None ***
TypeScore
extracellular, including cell wall556
GO
*** None ***
*** None ***
*** None ***
Sequence
        292 bases(100 bases per row)
ATGGCATGTCTGCAAATGCTCTCTCCGCAATCTCTCCATGCCCTCTGCACCACCGCCATTGAATCCTCTGTCTTGCCCGTGGACACTCTTGCCGCCCTCG
TGTCGTCGACACCGTACAAGCTCGTGGCCGAGAGTTCTTTGGCATTTTTGAGCCTTTGCCCCCAAACTCCTCCAGCGCTTGCCAACCTATTGGCGTTGAA
GTCATGGGATCCCTGAAGGCGAGACTGCGTGCATTGTGGCATTTGGAGGGACCTGTCGTGTTTGCAGCCGAAAAGAGAAGGAAAATGGCTGA