Transcript Name :
Aphin_H310_13906
Orientation:
(-)
Number of Exons:
1
Description :
AlNc14C15G1693
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-200
NN-scoreoddsWeighted Score
0.9266.4370.013
*** None ***
TypeScore
nuclear565
GO
*** None ***
*** None ***
*** None ***
Sequence
        603 bases(100 bases per row)
ATGCCATGCCAAACTGCCACTCAACCGTCCCAGCCGACCCAACTGACATCCCGAAACATCCACCAATGCCTTGCGCTTTTGGAAAACCTTGAGCAACAGC
GCCAGGCTAAGCGCACACGCTATCCAACTCACGGTGCTGAAGAGCCTGACGAGGATGCTGACTCCACCGCTCCTGTCTACGACATGTTTCTCGAATCGCA
AGGACCTAACGGTATTCACTCCATGACCAATTTCAGCCCCGCCGAATTCAACTTACAGTGGTCCGATGTTCGCAATCATGCCTTCAAGCATTGGAATGTG
GGCTCTGGACGCAAAACAGAGGTGTCCGCCCGAGACATGCTGCTCATGCTCTTGACGCCTCTCAAACACTGCGGGACGTGGGACGTCGTAGCTGCCGTGT
TCAAACAGAAGACGGCAACTTTCGAAAAGCGTGTGAAGACATTCCTCAGAAAGTATATTCAGTCGATCGGCGAGAAGTGGTCAATGCTTCAACTGGTCTC
AACCGCTCACCATTTCCAGAGCATTCCTTTCGCTCGCTATGCAATGGGCGAGACGTTTCAGCAAACCAACATACCATGTGGATCCTACGCCGAGAAGAAG
TAG