Transcript Name :
Aphin_H310_13908
Orientation:
(+)
Number of Exons:
9
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
MRG domain47.187PS51640
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
MRG domainIPR026541
*** None ***
InsideOutsideTMhelix
1-323
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4404
Sequence
        2059 bases(100 bases per row)
CCGCGCATGAAGGCAGCCAGAGCAACGAGCAAAGGAGCCACCGATGCTGCGATCTTTGCCGTGAACGATACCGTTCTCGTAAAGCATGGGATTGAGATAT
TCGATGCTAAGGTCCTTCGCTTGGACGAAAACAGTGAGTCGCTGTCCATTCCTGCAATGGGAATGGTGTTGACGAAGTAGTGGTTGTTGGCTTGGACAGG
TGATACTCCACACTACTTTGTGCACTACAGCGGTTGGCACAAGAAATGGGACGAATGGGTGTCTGCAGACCGCGTCTTAGACACGAGCCCAGAGTCTCGA
GAACTTCAGAAGCAGGCCAAGTTGAACGCCAAAGAACAGGTATGTCGAGGGCTTCCACCAGTAATCTATAGCACTGTTTCGGACAAGTCCATGATCTTTC
CATTTGCAGGTGAAACGTAAGGCCACAACTGCGACGATCACTTCGTCTGGTACTGGATACGCAGCGTCATTTGGGGTTTATTCTCACATGACTGGATGCA
GGTGTTACCAAGAAGAAGACGAAAGTAGTAGACCCATTTGATGACGCAGTTGTCGTCAAGGACCATGCGCGGGATTTGGAAGAAGTATCGTTGCATCGCT
TGGTTCTTACAACCTGACAGCACGGTTAGGTCGTACAAGAAGTCCAAGTGTCCATTCCCATCCCGATGACCCTGAAGAAGATTCTCATCGAGGACTGGAA
GAAGATCACCCAAGAACAGCAATGGATCGATCTGCCCCGTGTTCCTAACGTTCACACGGTATCAATGCAAGTGTGTTTCCGGCGCACTCATATTGCATTC
TCACGAAGGTTATTGCTGACTACCTTGAACACGAATCGTCTAAAGAGCACGACCTCGAGGTTAGGCTTGGCGAATGTTGCTCTTGCGAAAATTAACATAT
CGTAGATTACGCGCCCGATGTTGGAAGGGCTGGAAGCGTATTTTGACCGCGCATTGCCGTTGATTCTCCTCTACAGGCAAGAACGTGAGCAGCATGACGA
AATTGCTGCGACTTCCAAAGTGAACGACGACAGCACGGTTGCAGTGCGTGCCGCTTCAGCCCCCTCATCGATCTACGGCGCGGAACACCTTCTTCGTCTC
TTTGGTACGAGTGGAGTTATCCAATGGCGCATTCATCGTTGTTCTTAGTACGCTTACCGCTGCTTATGAGTCAAATGGGCTTGGACCTTCCCCAGTCGGA
CCAAACTCGCATTCAAAGCACCATGACAGCGCTCCTCAAGTTTTTGCAGAAGAATCGCCAAACGTACTTTGTTCCCCACTACATAGGTTCGTTCCCGTGC
TCAACCACGCTGCATCTTAACGAGTCATGGTCTAGCATCCACGAAGTTTACATGGCGTCCATTGCCGGTGTCGGCCGCAACGGACGCTCCCACCAAGTGA
AAATGAAATGTGCCATCATTATGCTTGTGGTATAATTTTCGACGAATCACATCCCTTTATCTCAATCCTAGCGCACGCTGATTGGTCTATTCCGAAAACC
CCCATACCAACATGGACCAATGAGCGAGAACTGTGAAAGCGCGCGAGAACATTCATTTTCGAATTTCCGACGTGGAGACCACACCCTGATCAGAAGGCGT
ACCCAGTGCCGATGAGGTTGCGCACGTACAGAACTTGTCCGATCGCGAGGGAAAGCAATACGATATTGGTGAGAACGGTCCCCCACACGACTCGTGACTG
CACCGTCTCCGCAGCTACAGCGCATCCATCAATGTTTCACGTGGGGTAGTCGGTAACAACGTACTGTTTCGACTGTGACGTTCGTTTTGGATGATCGAGA
TGAGCTCTCCTTTAAGGTCCCACACGGAGTAGCGAAAGTGACCAATTTCACGCATGACGTCCAACCCCATGTCCTCAAACGTGATAACAGGGTAATGCGC
CATAATTGAGTGCGCATTGCCAGTGAGCCGTGCGGAACCACCTTCGTCCGCGACTTGGATTGAATACACAATCGATGGGTAATCTTCCGCGTTCATTGCG
GCTACTCAGTTTAGTCGACGACGATCCACGGCAAGTTGAAACATGAGCATGGCACATAC