Transcript Name :
Aphin_H310_13918
Orientation:
(-)
Number of Exons:
34
Description :
kinesin-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Kinesin, motor domain9.5PR00380
Kinesin, motor domain9.5PR00380
Kinesin, motor domain9.5PR00380
Kinesin, motor domain9.5PR00380
Profile scan predictionP-Valprediction_id
Kinesin, motor domain49.084PS50067
HmmSmart predictionP-Valprediction_id
Kinesin, motor domain2.8SM00129
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1306
*** None ***
*** None ***
TypeScore
nuclear783
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
microtubule bindingGO:0008017IEA
microtubule motor activityGO:0003777IEA
microtubule-based movementGO:0007018IEA
*** None ***
*** None ***
Sequence
        5790 bases(100 bases per row)
ATGACCGGTGTCACGCCGCCGAGTGGCAAAGCTGGCTCGCGGAGCGAACTAACTTGGACGCACAACATGCAGCCGAAGTCGCAGCGCTGCGTCATTGTAA
ACTTGCCATGTGGGGTCCATGAACTGATCCTGTGCATGTGTGAAGCGTACGACATGGAGCATGCTCGGCTGAGCGCCATCGCCCATGTGCAGCGCGACAA
CGCCATCCGAGCGTTGGCATATAGCGGCATGCAGTACACACGTTTCCATACATGAAAACATGGCATAAAGCGACATGTAGGATCGAAGACTGGCGGTGGG
AAACCCACTTGACACCCGACAAAGTGGTCGCAATGACGCCGTCCGACCCGACGGGGGTGGCAGTGGTCCAGGAACCACCATTTGATGTCGCCGAATGGAT
CAATTGGCTCATTGAACGGGCATTGCGTCAAGCAGGTATGTCTGTGTGACTTGGACGGTGCTTTCGAAATCGTCTGGAGGGATTCTGGTGCTTCCATCTT
GGCTAAAATCGGGCCACCTTACCTTGGCTCGTTGCAGACGTCACCGCGCTGCAAACGGCGTTGCTCCATGCTAACGTACGCGCCACAGCATTCCCACGCA
AGAGGGAGACCGCTTCATCGGAGTGGATTCGTATTAGATGCAACTGGCTCGCACACAGTCCTTGTACGACGACTTGGTCGTGACGTCGGAGGTGGCAGCC
GCGCTGTCCAGTGTAATCACAGATGTAGTCATGGGGGGTGAGCAAACGACCGACGAATCCACCCACGATTCAGAGAAACTTGCTTAGGCACGACCTCAGC
ACCGCGACCCGTCTTGGAAGCTGCGACTGCCCAAGCCGTGCCGTCGGCAATGGCATCACTACTCCAACGCACCAAGTGGAAACATCGTGCAGATTTGGAG
GTGCGCGCAAATGATTGTGGCCCCCACCGGACACGAATGCGGTAGCCGCCGCAAGAATACGCCAACCTGATCGCGTGCGAACTCGACATGGAAGTGCTGA
AAGAGCAGCTCGACTCGCTCAAAGGTGGTGACCTGCCATCTACCGCCCAGGCCTTAACACTGAAAGGTTTAGCCCAAAGCACCACGGTCTTCCATGCTAA
AACTGCCGCCAAACAGCGCATCAAAGGTATCGTCACGTTGTGTCGAAGAGGGGGTTTTATGGGCTGGCAGAGTGGCTCCAGCAGTTCCAAGCCACGTACA
ACCGAGACCCGACGTTGTCAGATAAAGCACAGGTCGGTCATCAGTTCTTCCTACAATATTGGCCCAAGCGCACCAGGCCATTCCTTCCATTCATGAAGTG
GAGCGCCATTAAAATGGGTCGCTCGCACAGGTGAAGGGCTTGTACGTGGCGTTCAAGCAAGCCGAAGACGATCACACACGGCTCAAGCAGGTATTTACTA
GCCTCCTCCAACGACCTGAGCAATGTGTGCAGGACACGGCGGCAGCCAAAGCTGTGTACGAATTAAAAGTTGCAGAAGTCGAAGCGCTCCAAGGCTCGGT
CAACATGCGGCAATTCCCGCACCACACATTGGTACAAGCACGCGCACCGATCAAACGAATGCCGCATTCGTGCTGTTGACAGGTGGCGCACTTGCGAGCT
GCCTTGGACGATACCCACGCAAAAGTCGAAGCGCTTCAGTCGCGGCTCAAGACAATGACCGTCGCACCAGAGCCGCGCAACCCCCCCGTGCCGGACCAAC
GACCCCTCTCGGTGAGAACTGACCAGTCGACGAACTGACGTGGACATACCGGGGGGCAGGCGGCACTTCAACGGCAACCTTCGCTGCAAGGACCAGCCAT
GACCGCAACACCGAATGTCCCCCCAGCGATGGCCACGCAGCCGTCGTTAACGGCACTACCTGCCTCAGAACTCCCGCTATCATCCCATGAAGTTCGACCG
GTTGCTCCGTCTCCCTTGCCAGTATCTGAGGCCCTGCCCGGAATCGACGCGCCTTCACAGCCGGTTGTCGACACCCAAGATCCGCGCTTCTTTGACGTGC
AGTCGCCGCCCGTCTTGCGAGAACTCCCGACAGCGTCGTCAATGCAACGTGCCGGCGGCTCGCTGGCTGCTCCGTCCAACGATGCACAGAAGAGAGCGTC
GTTGGGCGCGTTTCCATCCATCGATGCGCTGTCCGTCATGTCGACCCGGGAAGGTCCGATGCCGGCGATGCCCGAAGGCAGCGCATTGCCACGACAAGTT
GCAACTGATCCAACGACCTCTCAGTCGGCAGAGGTTCGTGGCATCCATCGATTGCGCCGTCAATCGAGTTGTCGACACGCCTTGTCTAGGTCGTCCAGGA
TCTCCAGAACGCCCTGGCGGCCGAGGTGCGGCCGAACTCGCTGCTTCACGTTGGCTTTATGGATTTTTCGCGTGCTGCATGCATAGCACGAAGTCTCGCG
CGCATTGATGGAAACCCAATGTGCCTTGCAAGGTAGACCTATCTCGCAGCGGACGTGTGCCGTGACATGGTGTGTCCAGAGGAACTACTGTCGTGGCGCA
TCCAAGCGGCGTCGACCGGCGGAGCTAGGGTCGGCGGAGACGCATCCCAGGACGGAGATGATGAAGACTTGAACGACCGGGACGACCGCAACGGAGTCGT
CAATGGTGACCTCATTAGTGCCCAAACTACGTCAAGTCATGCCAATTATGTCTGCCAGACGCAGACGTCCCCGCTGACGTGGTGGCTACCAGCTTGGCCG
CCGAACCCAAGGTCAGTCGATCGCTCCACTTTGGCATCTTGATCTGAACAGTGGAGCCATGCAGTTGCAAGGCGACGTGAACGGAGACGACGTCGGCGCC
GCGATTCAGCGCGCGAAAGGTGCCATCGAAGCCGGCAAAATTGCGTGGAACCAAGGGGACAAGGCGGGATGCTACACCATCCTCGCGAGCGCCTGCCACG
CGATTCTCCCAGCTGCCAAGTACATGACATGTTGATAGAATCCGGTGAACCACTACTGTCGCAGGGGACATGCAACGGATGGAGTGGTCGTGAGTATGGC
GATCACGGAAGCTGCGACAGTTGGGCCAGCCAAAGGCGCGGTCGTCCTTCGCAAAGCATTGGACGCATTCGTTGCTGCACACCCCAACGCAGATGCAAAC
GTTGTTCAGCCACAGCAAAGTCAAGCCAAGGCGCAGCGCATGTCCACCGCGGCGGCCTCGAGTGGTGGAGGGGTACTGTCGCCACAGGACTTCGGTCGCC
ACGAAATATGACACGAACCATCTAGATCGACGGACCGGCCAAGAATAACGCAACCGCCGCCAACGAGTTGAAGCAAAAACTAAAAGTGGTCGAGTCCAAG
TGGAAGGTTGGCCAGATGACAGCGATGCGACCACATGCCCCATGGACGTGTAGGCCGACCGGGTCAAGCTGAACCAACTGGAGCAAGCCCTGGCCAAGGC
GAGTGCAGGTACTGCAAGACCTGTGCGGGAGGTGGCATGCAACCCGTTGCTTCGTGCAGGAGGAAGCAAAAGCGATGGCGACGCCGTGGTGGAGCGTGTA
TGGGCCAAGAAGCTCGCGGACGCGGAAAAGAAAGCTCAAAAAGTGTTGGATGACGTGCAAACCCAGTCGGCGCGTCAAGTCCATGCGTTGAAGTATGACT
CATGTTTATCGGGATCGCCACGATTCACGCGCGCCGACTCGGGCATGTGTAGAGCGGATTTGGCGCAAGCGACGGCAACTGTCGCGGACATGACTGGCCG
CGTGCACGAGGTACTCGACATTCCAGGCGCTCTGGGAGCTCCATCACACGATGCCGATGCTACCAACACGTCGGATAGCTCACGGCAACAGTCACCGCAC
TGCGCACCCAAACCGCGCGGATGAGCGAGCTCGAGAAAGACTTGGTGGTGTTCCAGGCCGAAGCTGTACGGCGGCGCCATTGTGCAATCATCATACGCCT
GGCGTCGCCAGTCTCATGGGTGACCACCGGCGTAGGCGACGGCAGCCACCTTATCGACGACCTTGACTACGTTGACGCAGCAGTACGCGACGCTGGAATC
GCAGTACCGAGTGCGCCGCCCGCCCTTCCATCGACCTCGTCGGTCAGCCAAACTGACGAGCTCGTCGCTGTGGCTAGGAAGAGCAAGCACTGCGCAAAAA
GTACTACAACACGATCGAAGACATGAAGGGAAAGATCCGCGTGTACTGCCGGTGCCGCCCCATGAGCACGAGCGAACTCGAGCGCGACTGCCAGTCCTGC
GTCCGATTTCTTGACGACGTGAGCCACGTGCCGGTCGCCAATTTTCCCTGCAAGTAATCACCTATTGCGCGCCTAGTTTACGCTCGAAGTGGACACTGCC
CGCGGCCCGAGGAGCTTTACCTACGACGCTGTTTTCAATCCATCCCACACCCAAGTAAATAGCTGCACCATGACAAAGAGCGACGGACGGGATTCACTCG
GTGGTGGTGGCGGTAGGATCAAGTGTTTGAAGATACCAAGCACTTGCTCCAGTCCGCCTTGGACGGGTACAACGTGTGCATTTTTGCGTACGGGCAGACC
GGGTCCGGCAAGACATTCACCATGACGGGTGACGTCCCATCGTTGGAATGGCAGGTACTGACACGGGATGGCCAGGGACGGAAGCGCACCCGGGCATCAC
GCGTCGGTTGATTCACCTCATGTTCTCGTTGCAAACGTCGCAAGGTAGGCATGCCATGACGTCGGTCGCGCTGACCGCACGGTTTGTAGCTGCCAACCAA
ACGATCGCTTACGAAGCGACCATGCTCGAGCTGTACAACGATCAGCTCATCGACTTGCTCGCGCAGTTGGATTCGTCGTACAAAGAAGACAAAGCGCCGA
AACTCGACATCAAGAAGAATGACAAGGGGATGGTGGTCGTAACGAATGCCGCGTCCAAAGCATGCACGTCGGCGGACCAAACGCTTCGCATGTTTGACGG
TGCGACACACGTCCTGGCTCGGGGGACGTCGCCGACGGACATCGACTTCTCGTGTAGCGGCCAACAAGAAGCGCCAAGTCGGGTCGACGAAAATGAATGC
TGAGAGCTCCCGGTCGCACTCGGTCTTCACCGTGCTCATTCAAAACTACAACAAAACGACCAAACAGGTGCGTCGTACTGGGAGACGTCGGTCCTGACCA
CGAACACGTCGCTGGAAGACGAGTGTGGGCAAGCTGAGCCTCGTGGATCTGGCGGGATCGGAACGCGCGGGCAAGACTGGCGCGACGGCCGAGCGGCTCA
AGGAAGCGCAGGCCATCAACAAGAGCTTGAGTGGTCGGTCGACGATTCGTCTGCCTGCACAGCTGACGATGTGGGTCCTTACCCATGTAGCGCTGGGCGA
TGTCATTTCGGCGCTCTCGACCAACGAAAAATTCATCCCGTATCGCAACAACAAGGTAGTATCGGTGGTGGTGGTGCGAGTCGACTGAGACGTTGCACTG
TGTAGTTGACGCAGCTCATGCAAGATTCCCTCGGTGGCAACGCCAAGACGGTAAAACACGATGCTGCTTCGCCATCGTTCCCGATACGACAACTCATGCA
TGTGTGTGGTAGCTCATGTTTGTCAACATTTCACCGGCCGACTACAACCAGGTGAGCCAGGGCCATCCGACCGTCGTGTGTGGCACGCTTTGACCATGTT
GAACTCCCAGGATGAAACGCAAACGAGCTTGTCGTACGCGGCAAGAGTCAAGTTGATCACAAACCAAGCCAGCAAGACATCCGACAGCGAAGAAGTTGCC
AAGCTCAAAGCGATCATCAAACAGCTCCAGGCTGGCGGCGTGCCCGTGGACGACGCGAGCGACGACGGTGGCGCGGCGACACGGCAATAG