Transcript Name :
Aphin_H310_13917
Orientation:
(-)
Number of Exons:
2
Description :
nucleolar protein Nop56
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Nop domain38.858PS51358
HmmSmart predictionP-Valprediction_id
NOSIC3.9SM00931
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
NOSICIPR012976
Nop domainIPR002687
*** None ***
InsideOutsideTMhelix
1-517
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K14564
Cluster Id
2729
Sequence
        1921 bases(100 bases per row)
AATGCGTTGCCATGACTGGGTCATCAATCGAACGTCGGTAAATCAAGGGAATTTGACCTCGTGAAGGCGATTGTGTTGGGATTGTAGTCGGTAAAACGAG
GGAAATGCCATTTGGTACATTGCCGTGTGGTTTTGATTGGTGGTGTGGGGACCAACCGCACGAGTTTGGATCCGGTGGCCAACCATTTTCCGATTTCCAC
ACGACAATGGTACGTGCCGCCGCCGCGGCGTCCGTGATCATGCGCTTCCCGTCGTCATTCGCAACGGGTGTCGAGATGTGCTCATGTGAGTGTCCTTGTA
GACTTCGTTTGTGTTGTTTGAGTCGGCTTCCGGCTACGCACTCTTTGAAGTCGTCGAAGCGGAGCAGATTGCCGTCCTCTTGGACCAAGTTCAACAAGGC
GTGCAAGATTTGAGCAAGTTTGGCGCGGCCGTCAAGCTCAAGGCGTTCTCTCCGTTTGTATCTGCGGAATCGGCGCTCGAAAACATCAACGCGATCTCGG
AAGGGTTGCTCACGGACGACTTGCAAGCGTTCTTGGAGTTGAACCTCCCCAAGGCCAAAAAGTCCAAGTCGGCCGCGTTCACGCTCGGTGTGTCGGACAA
GGGCCTTGCCCAAGCCATCACGGATGCGCTCCACCTTTCTGTCAACACGAACGAAACGACCCTCGAAGTCTTGCGCGGGGTGCGACTCCACTTTGCCAAG
TTCATTAAGGAGCTCGACAATGGCGTGTGGTCCAAGGCCCAGCTTGGTCTCGGGCACTCGTACTCTCGTGCAAAGGTAAAGTTCAACGTGAACCGCGCCG
ACAACATGATCATTCAAGCGATCGCGCTCCTCGACCAACTTGACAAAGACATCAACACGTTTGCCATGCGCGTCCGTGAATGGTACTCGTGGCACTTTCC
CGAGCTCGTCAAGATCGTACCCGACAACTACGTGTACGCCCGTTGCGCCGCCTTCATCAAGCACCGCACGTCGCTGTCCGAGGACTCGATCGAAGAGCTG
TCGAAGCTCACGATGGATGAAGACAAGGCGACCGCGATCGTCGCCGCCTCCCGCACGTCCATGGGCATGGACATGTCCGAATTGGACATGTTAAACGTGG
CCAACTTTACGTCGCGCCTTATCGGCCTCGCCGAATACCGCCTGCAGCTGCAAGCGTACCTGCACTCGAAGATGGGCCAGGTCGCACCGAACCTTGCCGC
GCTGATCGGCGACGCCGTCGGTGCCCGCTTGATCTCGCACGCTGGGTCGTTGACGAATTTGGCCAAGTGTCCGGCGTCGACCGTCCAGATCCTGGGTGCC
GAGAAGGCGCTCTTCCGCGCGCTCAAGACCCGCGGCAACACCCCCAAGTACGGTCTCCTCTTTCACTCGAGCTTCATCGGTCGCGCTGCTGCCAAGAACA
AGGGCCGCATCTCCCGCTACTTGGCCAACAAGTGTGCGATTGCGTCGCGCATTGACAGCTTTATCGATGAACCCACAACCGCGTACGGTGACCAGATGAA
GGAGCAAGTGGAGGAACGTCTGGCGTTCTACGAAAGCGGCGCGGCGCCACGCAAGAATGTGGACGTGATGGCGCAAGTGAGTGAAGCACTCAAGAATGCG
GCGCCACTCAAGAAACGCAAAAACAAAGACGGTGACAAGTCGGAGAAGAAGTCGAAGAAGGCCAAGAAGGAAGAGGCGGTCGTTGAAGCCGACGACGAAC
CGGTCGAGACCGAGAAGAAAAAGAAGAAGAAGAAGAAGAACAAGGAATAAGCACACATCTAGACGTGATGAGCAAGATATATACTAGTAGATATGGTCCC
ATGTGAGTCCGTGGAATCACGCCAGACGTTGTGGTCGTCGCGGAATCTGCTGGAGCGGACTCCTCGACACCCAACGCACGGCATTGCAATCAGCATGATC
TCCTAGGCGAATCGTCCATCG