Transcript Name :
Aphin_H310_13909
Orientation:
(-)
Number of Exons:
8
Description :
GJ16789
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
GOLD9.16PS50866
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8760.90726
InsideOutsideTMhelix
1-6
384-393
30-360
7-29
361-383
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
transportGO:0006810IEA
*** None ***
Cluster Id
2117
Sequence
        1758 bases(100 bases per row)
CTCACACGTGTCGTCGAAGCAAGATGGAGGTGCGCGGGCGCATTTGGTTCCTCGTCCTGTGGGCTTGTCTGTTGGTGATGCATCCCACAGCGAACGCGAG
CTCGTACTTTGTCTTTGATCTTGACGACACGGAAGAAGTACGACCCCTTTCGCCTTTGTTGTCCTGTGAATAAGACTGCACGTCGTAGGATTGCTATACG
GAAGATGTCGTGTCTCGCTCGGTTAACAGCGATGTCTTCCTTCACTTTGAAATCTTGGAGCCCGCTGTGACAGATGCGGTCGATGTGCAGCTCACATCGC
CGTCGGGTCGCGGGATCCAAGCGTGGTCGGGGTCGAAGGGCAACCACACGTCCATTTTGGTGCGTGAATCGGGGTTGTATTCGGTTTGTTTCACCAAGAC
AGGTACGCTCCCATGATTTCTTGGTCATTTTAACTCATGGACATTGCCCAGCGTCTTCCAGCCGCCGCTTGAGTATTTTGTACGCATTTGACCATGCCAG
TATTGGTTCGCGGACCTTGACCGTACGAAAGCACCTCCACTGACAAGCCATTCGCTTGACTTCGTCTCCATATCGTCAAATCGTAGCGCTATCCCGCATC
TGTATCGACCATTTTGCGCGAAAAGCCCGATGAAACCACCTATACAGAGCTGAACTTGGAGACTGCTGCCAACGTACGCTTCGTCTTGACGAATGCTTGG
ATTTGCCAATTGGCTTTGACTAGGGCGACGTACAATCGATGGGGCTGGTGCAGTTTGTCTTTTCGGGTGTTTCCAAAAGCATCATCCACGATAATACCAG
GTACCTCATCGATCACAATGCATGAACTTTTGCACTCATGATAATCACAGAATCATGATGAGTTTCTCCGTGGAATATGCTTCAGTGGCGGACTTGGGGT
TGAGCGTCGCTCTTGTTGCTGGTGGGCTGAAGCATCCATCCACGTACGTTGATGGTAGAAACACTGCTGGAGGTGTGACGTTTCAACGCTTTTTCAGATG
GAATGCAATGTCCGAGCATGTGCTAGCCTTTTCGGGGAAAGTCACTCAGACAATGGGAGCAAAGACTGGCGGTACCGTCTTCTTCGATATCACCGACGAC
GTCACAGGTATGTGCCATGCTCATGTTTCAACTTGCCGTGGATCGTCGTCGACTAAACTGAGTAGCCGCAATGAACGCGGAAGATTACCCATCGATTGTG
TATTCAATCCAAGTCGCGGACGAAGGTGGTTCCGCACGGCTCACTGGCAATGCGCACTCAATTATGGCGCATTACCCTGTTATCACGTTTGAGGACATGG
GGTTGGACGTCATGCGTGAAATTGGTCACTTTCGCTACTCCGTGTGGGACCTTAAAGGAGAGCTCATCTCGATCATCCAAAACGAACGTCACAGTCGAAA
CAGTACGTTGTTACCGACTACCCCACGTGAAACATTGATGGATGCGCTGTAGCTGCGGAGACGGTGCAGTCACGAGTCGTGTGGGGGACCGTTCTCACCA
ATATCGTATTGCTTTCCCTCGCGATCGGACAAGTTCTGTACGTGCGCAACCTCATCGGCACTGGGTACGCCTTCTGATCAGGGTGTGGTCTCCACGTCGG
AAATTCGAAAATGAATGTTCTCGCGCGCTTTCACAGTTCTCGCTCATTGGTCCATGTTGGTATGGGGGTTTTCGGAATAGACCAATCAGCGTGCGCTAGG
ATTGAGATAAAGGGATGTGATTCGTCGAAAATTATACCACAAGCATAATGATGGCACA