Transcript Name :
Aphas_H257_13057
Orientation:
(+)
Number of Exons:
1
Description :
PREDICTED: anoctamin-8 isoform X3
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-261
322-363
424-442
560-586
657-1178
1234-1289
1350-1361
1469-1490
1551-1624
285-298
387-400
466-536
610-636
1202-1210
1313-1326
1385-1445
1514-1527
262-284
299-321
364-386
401-423
443-465
537-559
587-609
637-656
1179-1201
1211-1233
1290-1312
1327-1349
1362-1384
1446-1468
1491-1513
1528-1550
NN-scoreoddsWeighted Score
0.622.1540.004
*** None ***
TypeScore
endoplasmic reticulum889
GO
*** None ***
*** None ***
*** None ***
Sequence
        5011 bases(100 bases per row)
TTACTGACTACCGGGTAACGAGCCCGATGCCGCACCGGGAAGAGCAGGTCCCCCTTGTGGTCAACCAGTCCTCCACAGTGTCAAAGGCACCCAACGAAGG
GTACGGCTCTGGTCCACCTGATTCGTTGGCTGTCAAGATCACAGACACGGCGACGTTGTCGCCGTCGCTGCATGTGTCGTACGACTATGTCCTAGCGTTT
CCTCACGATGCGCCATTCAACGCATCCATTTCCAAGCCTGACATTGTCCATCGACTGCATCTCGCTGGTCTCACAACCGAAGAAGTTGTTTCCAAGTCGG
CGGTGTTTTGCAAGGTCCGCGCGAACGTCACGCGCCTTCAAAAGGAAGCGGCGCGTGTGAACCTTCCCGTGCTTGTTGACGACGTCGTGTTGGCCGAAGT
GGCGAAAACGGGTCTCCAAGCCTTCCACATCGAGTCGTTTGAGGTCGAGAACCCGCCGCGGCAATGGCTGGACTTGTTTCGTCGACCCATCTATCCACCG
TACAGTCACATTTACATGCCATACGCAAAAGAGTCAGACCAGTCGATCTACGCTTCTCACGACGGCGCATTCTTCTCGAGCATTCATCGCATGCAGCTCA
TCGAGAGCATCCTCACCAACGTCAACGGCGGCGGCGCCGGCCTTGACCTCGACCTGCTCACGTCGGAAGGCGTGGTCATTGCTGCGTATCCATTGCACTG
CGACTCGCAAAGGCTCACGTTGCAAAAGACGTGGATGGCATGGTGTTATCCGCCATGGCAGCAGCCACTCCAGGGCATCCGCGACTACTTTGGCCCCAAA
GTCGCCTTGTACTTTGCCTTCCTCGGCCACTTCACGACGTACGTGCTGTGGGCGGCACTCGTCGGACTCGCCATCACGACGCTGCAGATCGCGCCGTCCA
AAGTTTCCATGTACGTCGAGGCGTCTGCGCTCACGTACGTCCTTCCCATCTTTGGCGTGGCCATGATGCTATGGGCGTGCTTCTTCCTCAAGCACTGGAA
GCGGCGCAACGCCGTCTTGGCCTTAGAGTGGGGCATGTCGGACCTAGACAAACACACCCACGACATGGTGCTGTTTCGAAATCGCCCGAATTCCCGCGTC
GATGCCGTGCTGCGCGTGGGCGGGTCGTGGCTCGTGCTCGTGGTGTTGATGGAGGCGATCGTGCTGGCCGTGGGCGCCGTCGCGCGGCTGTATGTGTCGC
CGACGTGGGGCTACGCGCAAGGCAACATGACGCTCTTGGCGGGGTTGATCGTAGCGCAGATTGTGGCACTGTCGACGGTCTTTCAATGGTTGTGCGTTAA
ACTCAACGAGTACGAGAACCACCCGACGGCGTCTGCGTACGAGCGGTCGTTTGTGCTCAAACTGGTGCTCTTTGAAGGCGTAAATCACTTTGCAGCATTG
GTGTACTTTGCCTTTTACGTACCGATGAACCCCCCCGACTTCGCATGGCTCGTGTACAAAGTGTATGGCGCGTATATTGTCGTGTACCACTGTCAGCGCG
TACTATCCCGACGTCGGAACAACCAGCACCACCCTCGGAATGAAAGCGGCGACGATACTGACGACGACATGGAAGGACAGTTTGCCCTGGCCGAGTATGG
TTGGAAGGACAGTATGTTGGACCACTTGAGGCTCGTCGTGCACTTTGCCTTTGTGACCGTGTTTGCCGTGTTGTGCCCGCTCAACCCGTTTCTATCGCTC
GTGCATTACTCGCTCGAGCTGCGATTCAACGGCGCCAAGCTGCTCACGTCGTGCCGCCGTCCTCGTCCGCGCGGCGCTGAAAACTTGGGCATCTGGTACG
TTGTCCTGCACTGGGTGCTCAACGTCGCCGTGGTCACCAACGCGTGGCTGCTCGTGTCCTTGTACCCGACCCAACCCCCCACGACCCCGGCGCCGCCTGG
ACCCGCCTCGCTGGCCGCCATCTCGTCCCAGCACGTGGTGCTGTCGTTGATCCTGTGCCTCGTCGTGTGTCGCATGCTCGTGATCGTGGGGTACCAAGAC
ACGCCGTCGCGCATTCGGCTGCAACTGGAACGCCAGGCGTACTACGTAGCTAAACTGTACCACAAGGCGTTTGGATGGCCCGGGCACATGGCCGCCAACA
CGTCAACCCTGGCGTTCGAGTATTGCCTCGCATTTCCCAACCCCGAAGCCCTCCCCAAGAAGTCCCATTCTCGTCCGACATCCCCCAAGCCGGCGCTGTC
AACGGTGCTGGACGCTCTCAAGAAGGCCAACCTCGCGTTCAATGTGTACCCGTCGGCGGCCAAATCGTCCACGTACTTGTCGTCGTTCATTTTCTGCGAA
GTGCGGGCCACGGAGAGCCAGCTGCAGCAGGAAGCGGTGCGGATGCAGCTGCCCATGCTTCTGGACGAGATCATGCTCAAGGAGTTGGCTCACGAAGGGG
TGTTCCATGCGCTGCACAAGGGCATGGTGGACGTTGTGGACCGCACGCGGATCGAAGCTACGAGGGTCAACTTGTTGCTACTGCTGGAGAATATGCTCAC
GCAGCGGGTGTTTCACAGCAACGACTACACGAACGTCGAGATGGCGGACAAGCTCGAGAAGTTGCTGGCCGCGTTGCACAACCGCGAGCCGCGCACGCAC
GTGTCGTTGGCCCACGTGCTCGCGAATTTCAAAGAGTTGATTGAAGTGGACATTGAAGGCGAACAATTCCGACAGCTAGATGTGCCGCAAACGCTACTGA
ACCGCATCGAAACGTACTTGAGCACGGGCGACGCACAGCCGACTACACCCACGTCGGATGTACACCCAAACAACGCGTTGAGCTACGCCAACAAGAACTT
TGACAAGTTGCTCAGTCAAATGGTGGCCTCGCTCCACGAACGCCCGCTCAATACATTGTACATGGCGCAAAAGACTTGGAAGTACGGGCTGGAAAAGGTG
CTGTGGTGCATCGAAGAGCTACTGAAACACTCGGACGTGTCGGTGTTCGAACTGTCGTCGTCGTCGCCGTTGAAATGGCTCTCGATGCAGCAATACCTCG
ACAGCTTCGACTCGGAAGTCGTGTACCCGCACCTGAACAGTCTTCTCGTCGAGTGCATGTCCCTCCTCGAAACCCCCGGCGCGAGTCCGTACAAGGCGTA
CCAGGAATTCCGCGCCAAGCATCCCCACTCCAAAGTGCTGGAGCTCGTCACGTCGCTCGAAGCGTCGATCATTGCCAACCCAGACGTGGACATTGCTCCG
TTTTACCTCGGGAATCCGGACCCCAAGTACAACTTGCTCGCCAAGCGGTTCAAGTATCGACCGTATCAGTACCTGCATATGCCATACCGTCGCCAGCTGG
GCAAGTGGCAGGAAGTTTATGCGACACCGTCGTCGTCGTCGTGCTTTAGTCCGGTGCAGCGCGTTCAGATTCTGGACAGTCTGCTGCAGCGTCACATCCA
CACGGACGCGTTGCTGGCCCAACGCGTGCTTGAATCCGCGTTCCCGCTTCATGACAAGACAGAACACGACTTGCTCAAGAACGCGTGGGTGCCGTGGACG
TTGTCGCAGCCCCTCGACCGCATCCACCGCTACTTTGGCTCGAACGTGGCCATGTACTTTGCCCATTTGGGACATGCGACCAAGTGGCTGACGTTCGCCA
TGCTCGCGGGGGTGCTTTTCTTCGTGTGGCAGCAGTCTAAGTACTCGGTGGGCAATGCTGCCCAGGTGTGGGTCGTGCCCGGGTTTGGTGTGCTCATGGT
GCTGTGGGCTACGCTCTGGCTCAAGCATTGGACACGCGTCACGTCCATATTGAAACTGCAGTGGGGACTGTACTCGACGGCATCGTCGCCGCAGCCTCAA
CAGGTTCGAGCCGTGTACACTGGCGACTTTATCCGCAACCCCATCACTGGCCAAAAGGTCAAGTACTTTCAAAGGAACGCCCGGGTCGTGCGATGGGTGG
TCGGGTGGGGGGTGCTGCTCCTTGTGGCCGCGGTGGCCTTGAGTGTCCAAGCCCTCATCTTGTACGTGCAGGCCACCACATCCCGCGGGACTAGCGTCGG
CATCGCGTTCGCTCTAGGGCTGTGCATTGTCGGCATGAAGCACATGTTCAATGCAGCGATCGTCCTGCTGATCGAGTACGAGAACCACCGCACCGAAGTC
ACCTACCAAGGGGCGTACGTGCTCAAGGCGGGGGTGTTCCACGCCTTCAACAGCTACGCGTCACTCGTGTACATGCTTTCACAGACCCAGTTACGCCACA
TCAACTCGTTGTACGTGATCTACGGCATGGAAGTGGCCGTCACCCACGTCATTCGCGTCGTCCGCCTGGTCACGCAACCAGCTGCGATGGCCACGGGCGA
GCAGCAGTTCTACCAGGGCGACGCCAACTGGCAAGCGAGTATGGAAAACCACATCGACCTGGTCATTCGGTTTGGGTACATGCTGGGCGGGGTCGTGGTG
TGTCCACTGGCCCCGGCGGTGTCTTTTCTGGACCACATCATGTCCCTGCGACTGCAAGCCACGCAACTCATGAGCATCACCCGCCGCCCTCGCCCCGCCG
TCATCATATCCACCTGGTACTCGACCATGATGAGCATCGTGTTGGTGGGGGCGATCGTGTCCAACAGCTACTTGGTGGTGTTTGTGGTCGAGACATTTGG
TCCTGCCTCCATCGTGTCCACGTTCGACGGATTCTGCGGCGTGCTCCTGGCGATGGTGGCCGCGCGCTCCGTGCTTAATTCGGTGTTCAACGACGTCCCG
ACCCGCGTGAACTCGCAGTTGGAGAGACAAGCGTTTTTGGTCGAATCGATCCTCAACGAGCAGCCCCCGGTCCCTTTGGCCACCATGGCGACTCACTCTG
CACCAATGCGACCGACCAGCGTCAGTTTGCAAAGCGATTACAGCATGTTGAGCCAAGACGACGATTTCGACGACGAAGTTGAAGCTGAAGGCTTTGTGTG
AACACAAATATGACGTGTACTACTACTGTATTTCCCGCTTCGTTATTCGATACAGTACTCCTCTATGTCCAAATGCGTCAACCGATAGACGGTTGAGTAC
AGGATGCTGAC