Transcript Name :
Phyag_g10101
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_511709
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phox homologous domain10.008PS50195
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-707
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        4196 bases(100 bases per row)
ATGGCCTACCTGACCATGACGCCCGACGACATCCAGGGCGACTACACGTGCGCCGTGAGCGTGGACGACTACCGCCTCACcagcaagaaggccgagTACA
AGGTCGTGGTGCAGCTCTCCTTCTACTCGTCGCGCGCGCACGCCCAGGGCCGCACTTCGTGGCACATctggcgcagcttctcggccttccGCAAGCTAGA
CGAGCAGCTGCGCAAGCGCAACGCGGCGCTCATGAAGGGCGTCAAGTTCCCGCCGCTGTACCGCAGGAAGGCGCTGTTCCGCGCCGATAAAAGCCCAGAG
TTCCTGGGCGGGAGGGCCAGAGAGCTCGACAACTACGTCAACGTCGTCACGCACAAGCCGCAGCTCGTGGCCTTCCACTTGGCGGCCGTGAGCAGCCAAA
CACTCAAGAGTTTCGTGGGTTTCAACTCGGGATTCGGCGCCAATGCCGAGTACGATCAGCAGGACATTAATCTACGGCCGTCGTCCTCTATTCTGGCCTC
GCCTGCGGTTGTGCAGGCCACGGCCAGCGTcatgggcgacgacgacgacgacttccgGTCGGTTTCGAGTAGTTCGACGGTCTCGTCCTTTGCGTCCACG
GCCAGTGACTATCGCTGGTCCGGGACTGGGTTTGTAGGCAGTCAGAGCTTTGCTAGACATACTGTACCTCAAGCGCAGATGGGCACCGGACGCTCGTCTT
TTGCCAGCAGTCGAGGATCTTTTGCCAGCAATTCGTTCGCTGGTGGATCTTCTAGAGGAAGCTGGTTCCCGGCGTCGTCAGGCGTGTCGGATACTGGTGG
ACGTGCATCGATGGCCTCGGTCTCGAGAGGATCCATGATGGCTATGACTGCGCCGGATGTTATTACGCCGGAGCTGGACATGCAGCGAGCGAAGATGGAA
GATCAACTCGTGCAGATGGGACTGGTTGGCGTTGGCATGCCGCCTGATGGATCGTGCTTGCTGCACTGCATTGTCTACGAGATGTATCCATTGCAGTGTC
TGCGGGAGTATCCGGCCAGTATGACGGTGGTGAATGTCGGAGCGGCGGACGGTATGGCGCCTCGACGAGTGGCGGCCGCGCAGTTTTTGAGGGTCAAGTT
GATGGAGTATGCGTTGGAACACATTAAGGCACTCGCAGGCTTTTTGatgcaggacgaagaggacgtgCGTGAACGATACGACACTTTCAGAGACACGCCG
GACGAACAGGCAACGACAGCCGAGTTGTATGCGGTGGCCAGCATGTTTAACATCGAGTTGGTGCTCATTTCCAACGACGAAAGCTTCCAGATTGACCCCG
TGCTGCCAGTAGAAGGCCTGCCGTCAGTGCGCGAAGGTCCGCGACGCACGGTCACGCTCGGCTATTTAATCCCAGCCGATGGACTTGCCGGACACTACAT
TTGCACGCGCGAGCAGCGGGCGCAAGTAGGCGTGCCTCGGAACAGTTTCGCTGGAGGAAGTTACCGCGGATCCATTCACATTGGGCCTCCGAAGAATATG
AGCTGTGGCGCCTCGAATAACAGGCGCTTCGAGCGGATCCCGGAGCAGCGGGTTGAATAGACCCCGTGGGTAGCATTAGCATGCGTGCCGACAGATAGAA
ATACCAACAACAGATCAGGCACATCAACACACAACACACAACAAGAGTAGCGACGACAGACATCACAACGAAAATGACATAACCCTCCAGCCTCGACAAC
CTGTCGAATGGACCAAGCACGGCGGAGAAGTCCACGTACAACGGCAGAAATCGAGAAGATCCACAGAATTTAGCAGCACCGAGCGCAAGTGGCCCCCAAA
AATCAAGATGAAGGGCGTTGCCTGCCCCCCAGAAAGCGAGTGTGTACACTATCGTGGCTGCGATTTTGCAACTTGGTGCTCGGCAAGATGCTCGACAGGC
CTATGCCAACTTCctctacagcagcaagcaagGTTTTTCAGAACCAACAACAAATGGAACTGCACGGACGAAGTGCCCTCTCTTTCAATATTTTAGTGTA
ACATGGTGTAGGCATGGCAATGAGTCGAACTAACCGATGGACTTCTCTCGATAGCAATGAAAATACATGTACGTGAGATTTCGCCGGCCTCGGGCCGTGT
GTGCGTGTGGTGTACGTTGTGCGCGTAAGTGTGGGTCCAGTCCGGGGTGGTGATGGTCCACGAGGATCCCTTTGTATCAATCCATCCATCACGCTTTTGG
TCAAAAGCTAAAGCTGTTCATTCTGCATTCTGCTGCCGAGAGAAAGAAATATGTCGAGACAAGGTCAAGTTTCTGATACTGTGTGTTTCGAGTGCACGTT
GCTCCGAGTAAAGGGCAGCTCTTTCTCAGTGGAATTGGAGAAGTGGAATAAGGTGGACGACATGAAGGAGGCGATCAAAAGGAAGAAGCCCGAAACGATT
GCTAGTGGAGCAGATTTACTGACGCTGTGGCGAACCACAGCGTTGGACGATGCTGGGAAGACAATATGGCTACCTGACGACTCCGACGCTGCACTGAGTC
TCAATCGGGGGGAGATTCACGCAGACATTGATACCTTGATCAAGAAAGAAGAATTGGATACGACTTTGAGCGTCCGAGACTTGATGACGAAGTACAAGCT
GGACGACCCAAGACAGAGACAGATTCACGTGCTCGTGGAGCTCCCAGACGAATTGGTGGCACAGCCAGCGATCAAACGGCGGAGATCATTGTGGGAGGAG
TCAACAACTCTCGGCCCCGCAGCGATATCCACCCCCTCTTGTAAGGGCGGAGTCTGGACACTTGATCCAAACGCTATTGCTGGCTTTGGTATTGGTAAAT
CCACACATAAGATGTGTCTATACTCCCGGGATGACGCCGACAAGTTGCTCAGGTTCATGGAAATCGATGTTGTGGATGGAGGACGGACTGGATATGTTGT
AGGAGCCCCTGGGTAACAGGTCAACgatcgctgctgcctttgctCTGGCGCTTGCACGCAGCACGAAGTGGATTGTCACGTGGATTAATTTGAGCCGTAG
AGATCCCGCCTGTTGCGTCTGCTTAGAAAGGGGTGAAAAGAAGACTACTCTGCTGACGATGCGCAGTATGGAAGACTTGATGAGTTTATTGTATGAGGTG
GACAACTCCAAGCAGCACAGTGTTTCTTGACGGGATGACGTCGGTTAATAGGGACGAAGAAATACTTTGTAGAGGCTGGCTACAAAAGAATTGGTCTACT
CACCGCCTCGTAGTGGTGACGTCGATGGCATGTCGAGGAATAGTGAACCCGGTAGATGATGATTATTTGAAGGTCAAAGAGCACGTTGTATCGTCATGGG
TTCTGGATGAATACCTCGAAGCGGTCAAAAATGACGGGCTGTTCGGGACTGTTGAAGGCCAGTTGGATGCGTCAGAGGAAGACAAACccgctgatgctgc
tcgttcGTTGGTTTGGCGCCGAACACTCGTAGAAGCCAAGCACTATTTCGCTGGCGGGAGTGCTCGGTACATGTTTTACTATTCAACATCGAGAGTTATG
GAATTACTGGATGTGGCTGTCGAAGTTGTTGACGACAACACATCAGCACCATTTGGTGCAATTGTGGATCTCTCAACCGATCCATGCAATCGACTTTACG
GTATATGTAGGGGGAAGTTGGAGATTATCAGCCGCTATGCCGGTTGCGCTCTAGTCGTTCAATGTGGTGTCGAGTTGATCAAAACGTTTGCGTTCCTTTT
ATCAAAAGATTCGAATGCTgcgatggatggatggattTTGGAGATGTACTTCTTCGCTTCCATTCGACGGGGcgtgtttgttgttgtcacGGAGGATCAA
CGTCAGATCACTCACCAGAAATGCGTGATTCTGGTTATGGACCCGAAAGCACCGCCAGAGCTACCAACCAAGGGGGTACGATGCCGTCTACGTCGAAAAG
GAGATTGGACTAGTTCGTTTCATTCAAGTGGCCAAGGCTGAAAAGCACACCCTCTTCCTCAACTACTTCAGGACTCTCTTAACTAatctggtggaggaga
acaGACTGTGAGGTCAAGACTGGAAATTTTCTTTGCCGtcgaaaagcagcagctcgataGCGGTGAATTCAGGATTACTACGATTACTAGCAATTTGGCT
GACTGGGGGTGGCCGGAGGGCGAAGAAAAAGATATCGTGAAGCGTGTTAGTGTGGAAGGAGTTGACAGCTGGGATGCTTTGGGCTGGTGCTCGTGA