/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_125ad71d83773a6239253986a0e4019e -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/112090 -w 120 -web -o /tmp/images/bd_log_output_file_125ad71d83773a6239253986a0e4019e
Transcript Name :
Aphas_H257_00056
Orientation:
(-)
Number of Exons:
3
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-207
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        712 bases(100 bases per row)
ATGCCGCCGACGACGTGGATCATGGAATGCAACATGAGCATGGATAATCCTGACACTATCATCTACGAAGATGGAACGACTGCTTCCTGGACCATGGACA
CCGAGTTGGGCGTGATCGACGACGGCAATTCGACCTGTGCTTGTATCTTCAAGTTGAGGCCCATCAGTCTCCTCGACTTCGAAGGATACGCCAGCACCCC
GAATGACTACCCATGCGCAACGAATGTCAAGGCGACCCCTCGAAGTGACAAGTACCGGTCGTTGCGACTAAGCGACAAGTGGAAAGCGTTCAAGAAACGA
AAACTGGCGAAATCGAATTCGTGCTGCCTAGCTTTCCCGTTCATGTCGATCATGGTATCATATCATTCTTGTGGATATATTCTAACATGTTATTGCAGAG
CATGTCGCTTCCGAAGCAGCCCGTCGACTTCGACCTGCAACTCGTATGCTTGAATCGAGATGCAGTTTCCCACCTTGTATCCCGTAGTATTTGCCGGCGA
AGAACTTTCTTTCGAAGCAGAAGAAAAAGGCTGAAATTAACGTGCATGGCAAGAAAGGAACAACACACGCCAACCTTCGTTCCCGTGCACCTGAAGTCCA
GCTCAAGGTGGAGATCATTGAGACTGCGATCATGTCTAATGGGAATTCCATATTGCCATCCCAGGTTCTCCACAACAAGGGCTCGAATGGACTTCATATC
AGCGTTACGTAG