/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_19404ad4d8bff62a7cdd14bf5bc7a2a6 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/112090 -w 120 -web -o /tmp/images/bd_log_output_file_19404ad4d8bff62a7cdd14bf5bc7a2a6
Transcript Name :
Aphas_H257_00024
Orientation:
(+)
Number of Exons:
1
Description :
Equilibrative nucleoside transporter 4
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-40
102-107
163-173
234-271
332-343
404-415
60-78
131-139
197-210
295-308
367-380
439-448
41-59
79-101
108-130
140-162
174-196
211-233
272-294
309-331
344-366
381-403
416-438
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1490 bases(100 bases per row)
CGTCTCATCAAGGACGGACTGCAGTAGCCATGTCGATCAAGCCACCGTCTGTCAAGTATGAGGCCATCCAAGCGCAAGAGGAGACCGTGGACGTGTTGGG
GTTGAATGGGATCCCGCTGACCGTGCTGGACGAGATCAAGCAGCACAAGGTGTTCATCACGGGGTCGCTCATCGTGCTGGAAGCGTCCGTCATGTGGGCG
TACTTCTCGTGCTTGTCGGCGCAGGACTACTACAAGAAGGCCTTTCCGTCTGTGAACTTTGACTTCCTCACCACGCCGCTGCTCACGTGGCCGTTGGTGA
TTGGACACGTGCTACAGGCGGGGTTCCACATCCGCCTGAGCTACAAGTACCGCGTGTCGATCGGGTACTTTCTCTTCGCACTGGCAGCCACCGTCATCAT
CGCCCAGGACTTTCTCACGCTCGACAACACGGTCGCGGCGTACGCGGTGCTGGCCAGCTTTGCCGTCGTGGGCATCGCGCACTCGGTCGTGGAGCCGGCC
TTTTACCTCATCGCGGCGCTCTTCCCCGACGAAGACTCGACGCACGCCGTGCAGATCGGCAACGTCGCCGCCGGCGTGATCAACATCGCGCTAAGCACAC
TCATCCGCGTGTTTGTCGGGGGGTTCGACCTGGACGAGAGCCGCACCAGCGTCACGCTGTCCTTCTACCTCTTCATGGGCCTGCTTCTCGTGGTATGCGT
CGTGGCTCTTGTGGTCTTCCACAACTTGGAGGCTCTGCCCTGCGTCAAGTACCTGCTCGACCGAGCGGACGACGACCACTCCAAGTACGGCCACCCGTCG
CTCCCCGACTTGTGGGCCAAGTACTGGCGCGTGTCCCAGACGATCGTTCTGCCCATGGTGGCGCAGTTTATGATCTTCTTCTGCTCCCTCGCGCTCTTTC
CGGGCGTCGGCTGCGCGTCCAGCCTGCACGTGCTAGATTCGGCGTCCGTACCCGCCGCGTGGTTCTGCTCCCCGGGCATCATCGGCGCCTACAACGTCGG
CGACTTTCTTGGACGGATCGTGTGCACCAAGGCCGTGTACACCATGCTCACTCTCCGATCGTGTTTTGTGCTGTCGCTCCTTCGGTGGCTGTTGCTGCCG
CTGCTGCTCCTGGGCACAGCCTCGAGCCCCCTCTACGCGTTCGAGGGGGTTCCCGTGGTCGGGTTGTACTGGGCACTTGGCCTGAACGTGCTGCTGGGCT
TCACCGCCGGCATGTTCAGTACCATCACTATGGGGCTGGCCCCCCGCCTCGTCGCGCAGGAGGACCGCGAGGCGGCGGGCTCGCTCATGGTGCTCAGTCT
CTTCCTTGGCCTAGCGCTCGGCTCGACGTTTGGCTTTGTGCTCGGTAGCAACCACTGGCTCGACATTGGGTTGTAGAATCACTACTATAGTACTACTCGT
CGGTGTCGTTAGGTGTTTTAGAGGTTTTGCCGATATACTACTACTCGTTCACGACTTTCAAGTGCGTTCCAATGTTGACTGTCCGTTCGA