Transcript Name :
Aphas_H257_00022
Orientation:
(-)
Number of Exons:
4
Description :
Cleavage stimulation factor 64 kDa subunit
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA recognition motif domain20.593PS50102
HmmSmart predictionP-Valprediction_id
RNA recognition motif domain1.2SM00360
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-339
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
KO ID
K14407
*** None ***
Sequence
        1329 bases(100 bases per row)
AATTTTCAAGTTTGCCAGGAACGATGAGCGGCGGTGGAGCAGGCAAGGGCCGCACAACGACGGCGAAGGAGCGCAGTGTCTTTGGTGCGTTCATGGGATA
TCCAGCATCATCGCATCTCATTATGCTGCATGTGGTTTGTCTAGTCGGAAACATTCCTTACGACGTCTCGGAAGAGACGCTGAAGAACATATTTTCTGCG
GTGGGACCGGTGGTGAATTTCCGGTGCGTGGAGGCGCTTGCTTGGGTCGACTGACTCTGACGCGTGCGTAGGCTGGTGACAGACAGGGATTCTGGCAAGC
CCAAGGGGTATGGTTTCTGTGAATATGCCGACGGCGCGACCGCGTTGAGCGCTATGCGCAACCTTAACGGCACAGAAGTGAACGGCCGGAATTTACGCGT
CGATTTTGCGGATGGTGGCGAAACACAAAAATCTGACAGAGGGGACAGGACGGCGGGAGTCAGCGGGGAAGCTCTCATCAAGAGCATCGAGAGCGCCGTC
GCGTCCCAGAGCCGCCTCGCGCTGTACGACATGCTGTCGGCGTTCCAAGAGTTCGCCCGCGCTTCTCCAGATGCCACAAAGCATCTTCTTGGAGCCAACC
CCGTGCTCGTTCATGCTCTCATCGAGTGTTTCAAGAAACTGAACATTTCCATGACGTCGTTGCCCCCTGTGCTCAAGGTACACAACATACATTCTCATGT
GGTGTTCATCCCATTCGGTAGACGCCGCTAATCCAACAGTACCCCGGCACTAGTCACAGCAGTAACCCCCCAAGAGGTGGAGGGGGTTCGCGACTGCCCC
CGCCGCCGCTGTCGGGTGGAATTCTTGGCTTTGCCCCACCCCCGCTTCAACACCAACACCAGCAGCCGCCGCCGTCATCTGGCCATACCAACATGATGAT
GTCGAGCTCGCCCATGCATGCTCCTCCTCCTCCTGTGGGCCGATCGGTGGCGCGGGACCCGCGAGCCCAGCGACGAGACCCGCGACTGGCGGCAAAGCGA
GAGGGCGGCGCACCCATGGGGACGGACACCAAGCGGTTCAAGCAGGAGCCAATGCAGCAGCAGCAGCCCCCGGACAGCGTCGTGGCCGACATGGCGCGAG
GCATGACGGCGGATAAACTGTCGCTGCTCCCTCCCAACGAACGACACATGTTGATTGCGTTCATGGAGCAAAATGGCATCCCGTACTCGTCATAAACACT
GTCCAAGATATTTTCACACTAAATAACGTTGTTAAATGCCATTGGCTACTCCAAGCCGTTTTCGTGGGTTTTGATTGGCTAGAAAGGAGCATTCCCCAAC
AAAGCAAAAGCAGAAAATAACATTTCGTG