Transcript Name :
Aphas_H257_00020
Orientation:
(-)
Number of Exons:
1
Description :
aspartic protease
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Aspartic peptidase1.2PR00792
Aspartic peptidase1.2PR00792
Aspartic peptidase1.2PR00792
Aspartic peptidase1.2PR00792
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5680.75718
InsideOutsideTMhelix
1-373
NN-scoreoddsWeighted Score
0.7282.4050.005
*** None ***
TypeScore
endoplasmic reticulum222
GO
Biological ProcessGO IDPrediction Method
aspartic-type endopeptidase activityGO:0004190IEA
proteolysisGO:0006508IEA
KO ID
K01379
K01379
K01379
K01379
*** None ***
Sequence
        1313 bases(100 bases per row)
GCAATCTCCTCGCCGAAATGAAGATCGCCGTGTGTGCTTTGGGATGGCTGGCCGCGTCTGTGGCGGCGGTGACCTTTCGCGTTCCCGTGACAAAGCTGGA
CGATGCGCAGTTCGTCGAGGGGTACCTGAAGGGTCAACGACTCAAGGCCCCTCGTGTGTGGGACCCCACGGGCCTGACGTTGGAGGACCACGGCAGTGTC
GTGATTGAGGACTTTGGCAACGCGCAATACTTTGGCGAGATCTCCTTGGGCACCCCTGGACAAAAGTTCAACGTGGTGTTCGACACAGGGTCGAGCAATC
TGTGGGTCCCCAACAGATTGTTTGGCACGCATCACGTGTACAACCACAAGGAATCGTCGACGTACAAGCCCAACGGCACGACGTTCCACATCCAGTATGG
AAGTGGGCCGGTGTCGGGCTTTCTGTCGCAGGACACGCTCCAGTTTGGCGGGTTGACCCTCACGGACCAGTTCTTTGCCGAAATCAACGTGACTAAGGGA
CTCGGGCCCATGTACTACCTCGGCCATTTCGACGGCATCTTCGGGCTCGCGTTCGACTCGATCTCCGTGGGCCACGTCAAGACACCGTTCCACCGGCTGC
TGGACACGCTGGACAAGCCCGTGTTTGCGTTCTACTTGGGCGACAACCAGCCGGGCGAACTCACGTTTGGCGAGCTCGACCCCAAGCATTACAAGGGCGA
CATCACGTACGTCAAGCTGTCCAGTGCTACGTACTGGCAGATCCCGGTCGACAGCATCAAGGTGGGCGGCAGCGAAGTGTCTGGCCCGACGCAAGCGATC
GTGGACTCGGGTACGTCGCTGCTGGCGGGGCCCAAGGCGCTGGTCAAGTCGCTAGCCAAGCAAGCGGGCGCCCATCCATTCATCATGGGCGAGTACTTGA
TTCAGTGCGACTCGCCTGGCCCGGCCATCAGCTTCACGCTGGGCGGCAACGTGTACACGCTGACCAAGCAGGACTATATCATCCGCAGCGGTCCCATCTG
CCTCTTTGCGTTTGTCGGGCTCGACATCCCCAGCGGACCGCTTTGGATCCTCGGCGATGTGTTCATGCGCAAGCATTACACCGTCTTTGAATGGAACACC
AACGGCACGTCTCGCGTAGGGTTTGCAGACGTCGCATAACGAAATAGCAAGCAGCATCACAAGTTGTTGATACTAACTACTATAGTAATGACTGAACTCT
GACTTTACTCTTAGTTACTGGAACATGCCAACGTGACGAAACGAGTAAGGTTACTAGTTAGCGGAGATTCTATAGAAAGTATGTAAACAAGTAACAGTGG
TTGAAGAGGTAAA