Transcript Name :
Aphas_H257_00017
Orientation:
(-)
Number of Exons:
6
Description :
guanylate kinase putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Guanylate kinase-like41.475PS50052
HmmSmart predictionP-Valprediction_id
Guanylate kinase/L-type calcium channel beta subunit3SM00072
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-264
NN-scoreoddsWeighted Score
0.712.5630.005
*** None ***
TypeScore
cytoplasmic565
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
KO ID
K00942
*** None ***
Sequence
        1153 bases(100 bases per row)
CAAATCTGACGAGCGGCCGCGATGGACAAGGGTGTTCAGAGTCTCACGTTTGAAGAGCTGTCCATCCTGAATGAGCGCAAGGAGGAGATCAAGCATGACC
ACAATGCGTACTTGGATGGGCATCCGGAGCTGAAGACCCTCCTGAGCTCGTTCATGTCTGCCGTCCTCATTGAGAAGCCAAGCGATGTGCTAGGCTTCGC
CAAAGATCACTTCGACGCGTTAAAACCCATCAAGATATCGGTACGGCAACCCAGCGTCCGCGGATGGAAGAGGGGTGTGTATGTGAGCTCAATGTACAAG
TGTAGCCGGACCCGTTGGTCGTGACTGGTCCGTCGGGCGTCGGAAAGGGAACGCTGATCACTCGCCTCCTGGGGAAATACCCGACTCAATTTGGGTTCTC
GGTCAGCCACACCACCCGTGATCCACGCAAAGGTGCAAGTGGTGTTGTCACCTATTCAGCAGCATCCTTATCCCATGCGTTTCTTAGGGGAAGTCGATGG
CGTCGCGTACAACTTCGTCACGGCGGACGAGTTTGAAAGCCACGTGCAAAGTAATGCGTTTCTCGAATTCGCCTATGTGCATGGCAACGGCTACGGCACG
AGCGTACGAGCGGTGGAAGAGGTACGTACACCCGTCCTTAGCGGTGCACGGTCCATGCCAACTCACCTTTCATGGTAGGTCCAAACCCAAGAGAAGATTT
GCATCCTCGACATCGACATTCAAGGTGCCACACACACACAACATGCATAGATATATGTAAGATCGTCAAAAACGTAGGCGTCCAGCAAGTGAAGAAATCC
TCGTCGAAGATGAAGTTTCTGTTCATCGCGCCGCCGTCCATGTCGGACCTGGAGAAGCGGTTGCGTGGGCGGTAGGCTCCAGTCAGTGTCATTCATGAAG
ATACAATGGTGATGTAGTGGCACCGAGGCCGAAGAAAAGGTGACGCTGCGCCTGGCCAACGCCAAAGCCGAGATGGACTTTGCAGCCCAAGGCCATTTCG
ACAAGGTGCTCGTGAACAACGACTTGGACGAAGCATTTGCCGAACTCGAAGAAACCATGGCGGAATGGTACCCCCAGTTTCGATTCAAATAAAGATATTG
GAACTTTGGTCAAATATCTTTATATTATCAAAAATTGGGGAGGAATTGCTACA