Transcript Name :
Aphas_H257_00006
Orientation:
(+)
Number of Exons:
7
Description :
phosphatidylinositol-4-phosphate 5-kinase its3
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
GPCR, family 2-like15.06PS50261
Phosphatidylinositol-4-phosphate 5-kinase, core48.208PS51455
HmmSmart predictionP-Valprediction_id
Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup6.4SM00330
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Phosphatidylinositol-4-phosphate 5-kinase, core, subgroupIPR016034
*** None ***
InsideOutsideTMhelix
38-48
114-132
193-212
1-14
72-90
156-169
236-697
15-37
49-71
91-113
133-155
170-192
213-235
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
transmembrane signaling receptor activityGO:0004888IEA
membraneGO:0016020IEA
KO ID
K00889
K00889
K00889
K00889
K00889
K00889
K00889
K00889
K00889
*** None ***
Sequence
        2667 bases(100 bases per row)
GGACATTTTTGCCGCAACCCCTTGTGGAGAAACAAGGCGGCATGGTAGGGTACGATGCCGTTGACGTGGCGACCTCGAGCCAGGTGTACTTGTGGATGGG
GATCGTCGGGTCCGTCATCCACTTTGTCACGATCTCGTCATACCTGGTCTTCCCGCAGCTCAAAACGCAGCATCCGTCGGCGAACCTCATGGTGTGGCAT
GTGGCATGCAACTTCATGCTCACGATCGGGTTCGTCGGGCAACACTTCCTCCTGGTACGCAGGATACTTCGTGCTTGCAGTGATATGTGTGTATCATGGA
ATAGGGAGAGGATGGGATGTCCGACGAAGGCTGTGCTGCGTTGTCCGTTTACAACCAGGTATGGCAAGGCACGTGTGTGGTGCATGTTGACACATTTGTG
GCGTAGTTTTTCATCCTAGGCAGTGGGTTGTGGTACATGATGCTGTCCTTGGATCTGCTCATTGCGCTGATCAATCCTTGGATGGGGTACGCCATCAAGA
CGTGGGCCTACCACACCATGTACGTCCAATGTCATTTCTCGCTCCAACACGAGTGTCATGCTTCGGGGTAGCACGTGGTCGATCAGCAGTTTGTCAGCGG
CCAGCATCTACTCCCTGCACCTCTACGGCGTGAGCTCGCTCAACATTTGCTGGATCCGGCGCACACTGGACGCCCGCGAACCCAACGACGCCAACTGGAT
CTTCCTCTTCGGGCCGGTGCTGGCGGTCTGGTTCGTGTCGTTCGCGGTGCTTCTCTTCGCCACGTTTCGCTTCGCGCGGCGTCAAATGGACTCGACGTAC
CGGTCCAAGCGCCGCAGCCTGCTGCAGTACTTCCGGTACCTGATCATGTACGGCGCGTTCTGGGTCGTCTGTGGGGGGCTGTACTACAGCGCGTACTTGC
GCTCGTTCAGCGGCCGATCTGCGCACCATATTGAACTGGCGTTCATGGTGGCTTTGGGGTCGTACCCGCTGCTCGTGGGCGTCGTGTGGGGCGTCAACAC
GGACCTACTCACGCACTTTCAAGGCGGCGACCCCGTGCTCGAGCCCAACGTCGGACTCACAGAGCACTTTAGCACGTCGCTTCGAAAGGACCTTATGAAG
TACGAGAGAGAGAGAGAGAGTGTGTGTGTTGGAATCTATCGTCTCGATTGATTGGTTGCATGTCACCTTTGTCCTGTTCGTGTATGTCTTGCTATTATGA
ATATTCTTGATAGTTTTCGCAGGACGCATGCAATATAATATACTGTATCGATATGTATTTATATATATTTGTAGGTACACGACGGTGGGGATTATCCGCA
GTCTGCGGGAACCGTCCGAGGACTCTCCCGTGCGCCGCACGGACAAGTCGCGGTCCCAGCCCCTGTCGGACCCCAACATCTCGCGGTCGCAGAGCATGAG
CAGTGCATCCGCTCGGTCGGACGAGTTTGAAGACGGCGGCACCCACCTGTGGTACGCCGAGAAGAAGCGGCTGGCCACCACCGTGCGCCTCAACACATCC
AAGCTGCAGGTGTACTACGACAAACTGGGGTTCACCGACTACGCCCCGCGGGTGTTTGCCAACCTCCGTGCCATCGCCGGCATCGATCCCGAGGCGTACG
AGTCCAGTTTTGTGGGCACGTTGAGTGAAATTGCGTCCGAAGGCAAGTCCGGCATGCTGTTTTACTTCACCAGCGACCGCCGATACATCGTCAAGACCAT
GACCAAGGACGAGCACGCGTTCCTGCTGCGCATGCTCCCATCGTACCATGCGTACGTCCGGACACAGCCGTCGACGCTGCTGTGCCGGTTCCTCGGCTGC
CACAGCATGCAGCTGCCCGTGGGATGGGACAAGATGTTCTTCGTTGTCATGGAGAACGTGCTGAGCACCCACCACGAGATCGACGACCGATACGACTTGA
AGGGTCTGTTCGCGCCGGTGCTGCACCCCCCGCTGCGCGTGTTCCTCAAGGACGACCAGACGGCGCGACTGCTGAGTCCCCCCCAGACGGCGACCAAGCA
GCTGTGGCACGACCACGAGTTTGTGGCTAGGGGGACCTACCTGAACGTCGCGTCCACCGCCCGCCTCGAGCTGCTCACGCAAATGACCAGCGACATTGGG
TTTCTCCAAGAAATGGACATCATGGACTACAGCTGCATTGTCGGGATTCGAGAATTTGACGCCGAAACCGAATCCACGGTATCTTGATTGGTCGTCTTGG
GCGTTGTACTCAATGAATGTTATACATAGGAGTTGCTGCCCAAGAATGCAATTGTGTCGGCCGATGCCAAGAAAGTGTACTACCTAGGTACACCATTCCC
AGGAATACCTACGATCCAGAGCCAGTTGCGCACCGTTTCGTCGCATTGAATGGTTTGTTGTAGGGTTCATCGACATCTTGCAATCGTATGGCTTGCGTTG
GAAGGTTCAGAACTTGGTCTTGTCCCTCGTGAGAGACAAGCGAACGATCACGGCGCTGCCCCCGCCCGAGTACGCGCTTCGATTCCTGAGCTTTCTCCAC
GCGCACCTCCTTCGGTCCAGTGCGGACGGCTCGGCGTCATTCAAGTCCATGACGGCCCGATCGTCGTTCAATTACGGCACATTGTAGGAGCATCTTTCTC
GTAACTAAACATGCTTTGCGTCAAGAGGAGTGATTGGTGACCTACATATCTCCCCATGGCCTCAACC