Transcript Name :
Aphas_H257_00030
Orientation:
(+)
Number of Exons:
13
Description :
PREDICTED: exocyst complex component 7 isoform 2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-646
NN-scoreoddsWeighted Score
0.5351.170.002
*** None ***
TypeScore
cytoplasmic565
GO
*** None ***
KO ID
K07195
*** None ***
Sequence
        2837 bases(100 bases per row)
ATGGTCGAAGGCGGTGCAGCAGCGGCGCCAGGGAGTGATCCCATCGCGGTAATACGGCGTGCGTTGATGGACAGCAAGGTAGTGACGTGCGCATGGCTCA
TCTGGCTGTGACGATGACGATGGCGTTGTGTGCACAATAGACTCAGCTGTCGACGGTGAACAGTGTACTCACCGGGTTCAAGTGTGGGTTGGATCGGCTG
GAAGGTCAGATGATGCCCATATACAACCTCACCGAGAAACTGCGAGAGACGCAAAAGAACATCGACTTGAGTGTGCATGAGCTGCGGGCTGTGAACGAGA
CGTTTGCGACCGCAACAGAGGTACGCCATCGTCGTCCCTGTCGCCGTCACAAGTCCGTCCAGGTGGCGCCAACGCTGCACCAAGGGGCCAAGTACGATCA
AGCGGAGTACTTCAAGGCGATGCATCGCCTCCTCGAGTCCATTTCGTTCATGGAATCGCATCGGGGGTACGAAGGCTGCGGAAAGGCGCTCGAGCAGGCG
CGCCACGTGCTCAACCTGGCCCAGGTCAAGTGCAAATCGGACATTGTAAACGACATCGGGCTCTTCTGTCGGTATGCCATGACCTCTCCAGTCTCGTCAG
ACCCAGACGACAACGACCCGTCGATTGACCAAGGGAAGGCCCAGCATGAGCCTGTTGTCACTGCTTCCCAACCCAGCGATGCCGACGTGGCCAAGGTGAA
CGCCCTCGTCCAGTGCTTGCTGGGCACGGGACTCGTGCCGCGGCAATTGCTGGTCGAATACGGCGAAAAGCGGCTTAAGCACATCAAGGACTTCTTCAAA
GACGCCAACCCCGCCACTCCCCCCGCCGACATGTACTGTTTTCTGCTGGATTATGTGAAATTAGTATTATTTATATATATTCTCGTCTTGAAATTAGTAT
TATTTATGTATATTTTCTCGACCACGATAATCACACGCTTGGGTTTAGATCCACGGCCCAGCATATGAAGGAATCCATCGGGCGATACCTTGACATGGTC
GTGTATGTGATCAAGGTACACCCACCCACTAGACCTACTACTAGTACTACTAACGTGTACTACTACTAGGTGGAAAAGGGGTTGGCGACCAAAGTGTTTG
CGACCGAAGACTTGAGCCATGCCGCGTTGAGTTATACGATCGCACCGCTCTTGGAAACGCTGACCCACGACGTGAAAAGGGGCACCCCCCATCGCAGTAC
TAGTACTACTACTAGTAGTACTACTAGTACTAGTACGCTGTCGAAAGATGACGTGTTTCGTCCACTGGACTTGCATTATTTGTTCAAAGCCAAAAGCGCG
GCGTTCCAGGATGCGTTGCAAGTACGCTGACCAAAATTATCATGTTAATATTTCCTGATAATTTTGAATAATCATTGAGAGATGATAGCCACCGCTGCGA
CTGCGAGAACACCCGGGCGTGGAGACGGCGGACCCGTGGAAACTGGTGGGGATCGTGGCCAAGATGGAGGACGAGCTGGCGGTGGCGGCCAAGTCGACGC
TGTCACAGTTTAAAAGCGATATCGGCGATGCACTCATGCAGGATAAACAACTCGGACGGTTCAGGGACGGCAACGTGCACCCCGTGTCTAGCAACGTACG
ACGTCTCCGTTTTTTACGATATGTGACACTGTTATATATGACGCTGGAGTGGCCAGGTCATGCAATTCGTGCGCCACCTGTGCGACCACGTCGTGGAACT
CGAGTGTCTGCTGAAATCGGACCAGACGACCAACGTCGCCTACTTTGTAGGTATGTTGTCACAGCTGCTGCTGCTCCATTGCATCGTTCATATCTTGACA
CTGTCACAGATTGCACAGTTTATATGTGTACAGTGTGGCTGTTGGCGGGGTATTTTGCTGCCTCTATTGTAGTACAGATATGGGTTACTAATATGGATGT
GTGATAGATTCCATCGTGATGAAGTTGATCGAGTCATTGAAAGCGTCAAATGTGATCAAAGGCGGGCGGGAGGACCTGCGGACATTGTTTACTCTCAACA
ACGTCATGTACATATCCCAGTCGCTCAAACAGCTGGGCCAGGACCTGCATACCCCAGCTCAAGCAGTCGTCACAGCAGCCCTCCAGCAAACGATCCAGCC
CAAGGTAGCCGCGCTCGGCGACAAGGCCATCCAGGACTTTATGCACTTGAGGTGGGAATGTACAAACAATTTGAATGATCGATAATCGACTCAGTAGTTA
CGACGAATTTGACGCGATTTTGGCCGACCCGACGACCAAGTTGCAGTACAACCGCAACAGCGACGTGCTTACATTGGACAGCGGCCGCCTCGTCAAAGAA
AAGTTCACGGTGGGTGTATGACCTGTCGAAAAAAAAAAATAATAAAATATATATATATATAAACATATATATATATATATTAATATTTTGTGTAGAAATT
CAATGCCACGTTGGACGAAGTGGTGGCCAACCAGGTATGATCCGTTCTCGTGCTGTTTTTGTTGCCAGTACGAAGACGACGTGATATATATATATATATA
TAAATATATATATGGTTGTTGTGTATGTCGTGGAGTAGAAATCGTATACGGTTCCCGACGCCGACCTGCGCAAGACGTTGATGGCATCGGCGTTGCAGCG
CATTGTGCCCAGCTACACTATCTTTTATGACAAGTACGTTGGCCGGTTTGGAGTTATCGATATAGACAAGGCGGTGGCTGTAGGTACTCGGTCGTGCATT
TCTCCAAGAAGCACATGGACAAGTACGTCAAGTACACCCCCGCCAACGTGGATGCGATGCTGCGCGAGCTGTTCCAAGGCCTCCACCACCCCTCGACGTC
GTCGCATACATCGTCGTCGCATACATCGTCGTCGTAA