Transcript Name :
Aphas_H257_00052
Orientation:
(+)
Number of Exons:
7
Description :
3-hydroxyisobutyrate dehydrogenase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-319
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00020
*** None ***
Sequence
        1914 bases(100 bases per row)
CGACGAAACAAGCAAGCATGGCGTCGTCGAAACTTCGCGTGGGGTTTATCGGCATTGGCATCATGGGAAAGAGCATGGCAGGACATATCCTTGTGAGTTT
TCTACATGCGTATGTGGTCTGGCTTGAGCATGATGCTGTGTAGGACGCAGGATACTTTGTGACAGTGTACAGCCGCACCGCAAGCAAGTGCGACGACCTT
GTGGCTCGAGGCGCCAAGTTGGCGCTCTCGCCTGCCGAGGCCGCGAAAGATGCGGGTACGACACACAATCCCATTGATTGCACTCTGTCCTTGTCCTTGT
GTTAACGATGCATTAGATGTCGTGTTTACGATTGTCGGGTACCCATCGGATGTCCGCGAGGTACTCTAGCCATTCTCTATGTGATCCATGGACGTTTTCA
TCCCATGAACGTACGCTGCCGTCCTCAGGTGATTCTCGGATCCAACGGCGTACTCTCCACGCTTAAATCTGGCGGGATTGTCGTCGACATGACGACGAGC
GAACCCTCGTTGGCCAAGGAAATCTACAACACGGCTATCCTTCAAGGCGTATCTTCCATCGACGGTAGCCATCTACTCGTCCTCGTTCCATGGCTCATGC
ACAATGCGTAGCGCCCGTGTCGGGTGGCGATGTCGGCGCCAAGGAAGCCCGCCTGTCCATCATGATTGGCGGCGACGCGGCGGCGATTGCCACTGTACAG
CCCTTGTTTCAAGTAATGGGCAAGAACATCCGACACATGGGCGGGGCCGGCGCCGGTCAACACACCAAGATGGTCAACCAGGTACATTCCCTTCACACAA
ATTGATTCATTCTCATCGCATGAATGGATGGCATTAGATCCTGATTGCGACCAACATGATTGGGGTCGTGGAAGGCTTGTTGTATGCGTACAAGAGCGGG
TTGGACCTGAACGAAGCCATCGCGGCCGTCGGCGCCGGGGCGGCGGGCTCGTGGTCCATCAACAACATGGGCCCTCGTATTGCCAAGCGCGACTTCAACC
CTGGGTTCATGGTGGAGCATTTTCTCAAGGACATGGGCATTGCGCTCAAGGAATCCCAGGCGTATGTGACATCGTTGCGATTTGCATGTGAGCTAACCAT
ATCTCATGGATACGTAGCATGGGTCTGTCGTTGCCTGGGCTGGCGCTGGCCAACCAGTTGTACCTCGCCGTGCAGGTACACTTTCATTTGTGATTCTGAT
GCATGCTTTTCTACTACTGATACTGAAAAATGTTGATATGTGTGTATTTGGCTCAAAACGACATATATATATATATATATATATATATATATATTTGTGT
AGGCGCTGCCCAATGGCCCGAAACTCGGCACCCAAGCGCTCATGCTCGCGTTTGAAAAGCTCAACTCGATCGATCACGCTTAAATAGTGTGGTAACATAT
CGTAACATGAGCATATGTGACACAGATATACACTGAACAGTGTCACATCACGGGCGTCTCTTGTCGAACGCGGCGCGCTTGGTCGAGTGCAAAGTGGAGG
AACCGCGTCCACTCGATCACGGCGGTGTCGTCCCCAAACAATTTGGGTCCGTTCGAGTGCAATGTGGCGACCACCGCGTCCCGAAACGGCTGATCCCCCG
CCGCCCGGACGGCCAGCCGGACGTAGTCGGCCGCGGACGTGGCGACAGTCGCGACGGCGTTGATGTGTCGGAGGACTCCGAACGGAACTCGAGTGCGCCA
CAGCTGTCCCGGCAGGGTCACCGTCGGCACCCCCGCCGCCACTGCCTATACACACGCTGCCACGTCAGATCCTGGCCGACTGCATGATGCTCTTATAAGC
GTTGGCCGCATTCTATATTGTCAAGTCCTACAGTGTGCACAAGTCTCGGCAGAACAACTTAGCCAATCATATTGCAGTAAATCATCGGACCAATAAACAA
CTATGTAGTGCGTG