Transcript Name :
Aphas_H257_00042
Orientation:
(+)
Number of Exons:
8
Description :
CwfJ domain protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-486
NN-scoreoddsWeighted Score
0.5541.2360.002
*** None ***
TypeScore
cytoplasmic435
GO
*** None ***
*** None ***
*** None ***
Sequence
        2719 bases(100 bases per row)
GCGATAATTCCAAGGTGTGGGGTGAACAACATGGTTAAAGTGCTGCTCAGTGGCGACGTCGGCGGCAACTGGGACGCTCTGCATGCGCGCGTTGAGAAGC
TGCATACGTCGGCGCATGGTCCCTTCGATGTGGTGCTATGTGCAGGTTTCTGCGATGTCTCTGCCAATGCCATTCGCGCGTGGCCACTGCCAGTCTACGT
ATTGGGAGGACTTGGTGATCAACCCAAGAACACGTCGACCAACTTGCACGTCGTGTCTGAAAACAGCGTGCATACGATCTCTGGGTTGCATGTGGCATTT
CTGGCGGACCCCGAGGCTGTTCAGAGCTTTCGCAGCGCGCTGACCGCTCAACCCGTCGACTTGTTGATCACGACCGACTACCCTCAAGGGTACAAACCTC
ACAATCTCCGTTCGCGACATATGATGATGGATCCATGGCATGTAGATTCGACCAGTTGGTATCTGTGGAGCAAATCCCGTCGTCCCTCCAACGCGTTGGC
CTCCAGGTATCGTCGACACGTGTCCACTCCTTGACCCTGTCGCATAGAGCATTGCCGAAGCCGTGGAAATGGCCGTGCCGCGCTACCACATCGCAGCCAC
GCATGGATTATTTTACCAGCGCCTGCCGTACGTGACGACCCACGGCGCCACGCGGCGGGTCACGCGCTTCATTGGGCTAGGCCAAGTGGGGGCCTCCCCC
GACAAGGACAAAAAGTGGATGCACGCTCTCAACCTTGACGTACTTCGCTACCGTTCGTTTCGACTCTAAGCACTCGACTTAGGTCTTTTCTTCGTCTGCT
TCTGTGGAGATCCCGGCGGGTACGACCCAGAGCCCATTTGAAGCCACCAAGCGACAGCGGCAAGACTCGACTGCTTTCCAACCGCGGAAGAGGCCTGGAC
TGTCGGCGGAAAAGGCCCAGCAATTGATGCAGCAAAGCAGCCAAGGGTCTAAACAGCATTCGTTCTACGACCACACACAGCACGCGCGACTGCCGAATCG
ACAAGAATGCTGGTTCTGTCTGTCGACACCCACCGTGGAAATGCACCTGATTGTCAGGTATATATATATATATATTATTTATTTTTTTGGTCAAAATATG
GACTTTTTTCTATGATTATTTTCCAAATCGATCGATCGAGTTTTTTAGTCCCCCTATATATATATTTGTCAGCCAAGATGTGGACTTGTATGTTGACTTT
CCAAATCTATCGACTGGGTTATTATTATACCTATATATACTTGTAAGCCAATGTATGGACTTGTATGGTGATTTTCCAAATCTATCGATCGACCTATTTT
TATTATATGTATATATATATACTTGTCAGCCAATATGTGGACTTGTATATGGTGATTATCCAACTCTATCGATTGTTTTTAGTAGTCCTGACTTTTGTAT
GCAATGCCTTGTTAAGATCACACGAATTTGAGTCATACACCACTTCCATTTATGGGTGTGATAAATGGGCAAATCCTTGTATCGATCAATACTTTTGAGC
GAAATCTCAATGTACGTTGCGTGATGGCAGTATTGGCAACGAAGCGTACTTGGCCATCCCAAAGGGCCCCATCGTCCCCGACCATGCGCTGATCGTACCT
ATTCAACACACTGCATCCATGACAACCATCAGCGCCGCCGCTAGAGCCGAAGTGAACCAGTTCAAAGCCGCCTTGACAGCGTGCGTCTATAATTAATATT
TCTGGAAATCTATAATTAATATTTCTGGAAACCCCCTTCACTACTGTGAGATTGTATGCGACATGGATTTTGAGTAGATTTTACGCGTCCCAGGGCAAGG
CTATGGTCGTGCTGGACCGAAATGTGACGACGTTGGGTGCAGCCCATGGCCACTTGCAAGTGATTCCAGTGCCCGAGGCCTTAGGTATGCCAATCCTCCT
CTTTCGATCATATTGTGGTTGGTATTCTATTTGGTATTTTATTTTTATTTTATCTCAGTATTTTGTATTTTGATACTATATACTAAATGATTGGTTTCAT
ACAAAAATATTTTATATTTTTATAAAATTGTCCTTTCAGCCAAACAATTTTTGGATTTGTGTGCTGATTCGCCAAATCCGTCGAATGCTTTTTGTACAGG
ATTTCGCGTCCAGTGTCACACTAATAATATATAAGAATCACACAGTAATTCGAGAATTTGATTTGGACCACTTCATTCGTATTGTCTTTGGTGCTGGTCA
TTCGATTGAGCACTCCAAGTCTTTCAAATGTCCGAATCCACAATATAACTAACTGGTTGGTACATATGTGTTTAGCGCCGTCGGTAGTGGAAGCGTTTCA
TAACGAAGGAACCAAGTACAAAGTGGAATTTACTCCGTTGCCAGACGGGGCCGAGATTGAAGCGTCCGAGTATTTGCTGGTGGAGTGCCCTAGTCCACCC
ACGCGGCTGCTGCACACAGTACACGGCAAGCACTACATGCAGTTTGGTCGAGATGCCGTCGCGGCACTACTCAACATGCCACGTCGAGGCAACTGGAAGG
TATGTACATTAGATGGACATGACTTTCTCAATAATGTAGCTCATGATATTACGTGGCAGTATTGCGTGGTCCCGAAAGACGAAGAGGAGAAGATGACTCG
AGATTTCAAGAACGCGTTTGCCCCGTTTGATTTTACGCTAGCATTGGAGTAATAACTCACCAACAAAAATGAACTCTCAAGGGCTGCTTTATCTATTAAC
GTTAGGATATATAATGATG