Transcript Name :
Aphas_H257_00015
Orientation:
(+)
Number of Exons:
1
Description :
1 putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
W2 domain13.486PS51363
HmmSmart predictionP-Valprediction_id
W2 domain0.0076SM00515
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-494
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1569 bases(100 bases per row)
ATGAGCCGAAAAGGAACGAAGATGGGACTCGGTGAGTTTCTCACCGAGAACAACAGCAACGTGCGCGCTGCGCCTATCAACGCAGGTGGTCTGGAGCACC
TTCCCCGCGGACCTCGTGAACGTACCGACGATGACAACGGCGGCTTCCGCGGAGGTCGCGGTGGTGGAAGGGACGACCGCCGCGAGCGTGAACCCATGCG
TGCCGACGGATCTGACCGATGGCGCGGAGACCGTGAACAACCTCGTGGTGGAGGAGGCTACCAAGACGACCGACCTCGACGAGACGAACGTGCCTTCGAA
GAACGTCCTTCCCACATGCGCTTGAACTTGACTCGCCGTGGCGAAGAATCCGCGCCCCCTGCCTCTGGCGGATTCCGCTCGTCGGATCGATTTGCCTCGG
CATCTGACGATAAATTTTCTCGCGCGTTCAGCAGCCGAGGTGGTGGCGACGACCGTCGCGAACCTAGCCGCTTTGGTGACCGTGACGGCGGGCGCTTCAA
CGACGGCCCTCGTTTCGGTGACCGCGACGGTGGCCGCTTCGGCGATCGTGATGGTGGCCGTTTCGGCGATCGTGATGGTGGTGCCCCTCGCTACAACGAC
CGTGACGGTGGTCGTCCTCGTTTCGGAGACCGCGAAGGCGGCGGACGCTTCAACGACGGCCCTCGTTTCGGTGACCGCGACGGTGGTCGGTTCAACAACG
ACGGTCCTCGCTACAACGACCGCGATGGCGGACGCTATGGCAGCGACCGTCGCTACGACGACGATCGATCGGCCAGTCGCGTGACGTCGGCGTTTGAGCG
CCAGACACTGGACGACCAGCCGGATCCGGCCGAAGTGGCTCGGTTGAAGAAGGAAGAAGAAAAGGCGGCTCGGGACGCGGAGAAGAAGCGCAAGGAGGCG
GAGAAGAAGGAGGCCAAGCGCTTGGCGGAGGAAGCGGCGGTGGTCGCTGCCGAGGAGAAGAAGGCGGCGCTTGCGGCGGCGGCGGACAAGGCTGCCAAGG
ACCGAAGCGTCGTGCAGACGGTGCTGGCGACCGGCAAGAAGGGCAAGGAGCTCGCCAAGGCCGCCAAGACCACGCTCAAGGGCGTGACAGCCGCCGTGGT
GCTGGCCGAAGTGGTGGAACACAACAAGGAGTCGGCGATCACGAGCTCCAAGTGGCTCACTCCGGACGAGTACGGATCGCTCCTCGAAGTGACGGTGGGC
GCGGCGCCTGCCAAGGAGCAGCTCCAGGCGCTGTACGCGCTGCAGCTGTTCATGCACGAGCACCGCGGCCGCGAAGGCAACCGCACCAAGGGCATGATGG
AGCTGGCGTTCAAGGCGCTGTACGCGTTTGACATTGTCTCGGACGAGGCGTTCATCGAGTACAAGTATGACACGGAGGACTCGACGGCCGGCAAAATGCA
AGCGATCATCGAAACGTCCGAGTGGTTAAGCTGGTTGGAATCGTACGAAGCCAGCGACGACGACGAAGAAGAAGAGGACGAATAGACAGCAAACATATTA
GACATATATAACACGAGTACGTTAGTAGTTTTTCGATTAACTAACGGGCAAGCCCAATTGAGTCCACAA