Transcript Name :
Aphas_H257_00021
Orientation:
(+)
Number of Exons:
5
Description :
metallophosphoesterase 1, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-6
30-400
7-29
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1671 bases(100 bases per row)
CACAATCTCGTCGACTATTATAGTAGTACTAGAGGCCGCAACCGAGCTATCCGGATAGTTGTTCAACAGGGTGTCAATGAAGTGGCGGGCCGCTTTGTTT
GTCGCGGCGGCGGCGGTGTCGAGTGGCGTGACGTTGTGGCTGTGTTCGACGCTGTACTATCAATACATCGTACATTCATGCGGGTCGCAAGCGATGGAGG
GTGGCGGCACGCGAGTCGTCGTCGTCAGTGATGCACACATGCTGGGCCACCGAAAGCGATCGACGGTGGAACGGCTGTGGGTGGACTGGCAAGCATGGCT
GTCCTTCACGACGATCGTGTCCAGGAGGAGACCAGACTTAATCGTGTTCCTCGGTGACCAATTCGACGAAGGCACTGCCGCCACGAACAACGTTGTGCAC
AAGGTACCACCGAATCAGTCCTCTCCCGCACTTTCGTCGCCCATCATCCATGGGGCTGTAGGAGTACATTGCTCGGTTTCGAGAAATCTTCGACCCGAAC
GTGGCGCAAAGCCTTCATTTGGTGAGTGTCATCCCAAGTTCTTTTGCATTGATGACACTCGACGGTAGCTTGGCAACCACGATGCTGCGTTTGGTCCTGG
GTTGACGGCGCCGCTGGTCGGTCGCCACGAGCGAGAATTTGGACCGGCCAATCGCGTCGTGAATGTTAACAACGTGCTCTTCCTGCAGCTGAACACGATG
GCCTTGGAATCCGACGTGCTGGACCAGCAAGTGCACCACGACGCCATGGCGTACGACCACCCGCCATATTTGCTTTGTCCATATGAAGTCTCTCCATGTC
CATTGATCGTGTCTTCCCGCAGGTTCTTAGACAGTGTCGAAGAGAAGCGCCGCAGCACTGGCTTCCCCCCACTGGTGCTGCTGACCCACTTGCCACTGTA
CCGTCCCGACGATCTGGCCTGCGGTACATATATATATATCGATTGGATCTGCAAAACACAGATAATATTTATGAAATCACGCGTAGGAGCCCAGCGAGCA
GCCGAGTCTGGCCACATCACGTACGAAGCGCCGTCGTTCAAGTACACGGAGCGCCACCACGTGCTGTCTAAAGCTCTGTCCGAGAGGCTGCTGGCAACGA
TTCGGCCGGTGCTGGTGCTGTCTGGCCACAGCCACGCCACGTGTGCCCATGCCCACCGGGTGCACTATCAACCCCATCCCGTCCAAGAATACACAATCCC
GACCTTTTCCTGGGGCATGCGACCAGATCCATCGTACCGTGTTCCTGTCCATGGAGCTAGTATTACTACTTCGGCATGGTAGGTTCGCCATCTTGACGGT
CCTCGACACCTTGCCCACGGCCAGTAAGGACGACCCATCGTCCGTGGGCCTGCACTTGGCCACATGCAGCCTGCCGCGCGAAAGCCACTTTGTTGCAGTG
CTAGTACTGGCGGCAGGGCTGCACGCGTCGGTGGCATGGGTGATATACAGCCACCTGTGGCCATCGCGGCCCCTCCACTCGCCTCGAAACGATTGAAACT
GTCAAGCAAGGTCACGAGCGATGAATCGTGCTTGTTTGTATCAGTATTCGTTGAACGTGATACTCGGGGCCTGTTCCAAGTAGATATTTTTAGCAAATGA
TCAATTTTGGTTCCAAGTACAGTTTCCTACTTTTTTTAAAACGAAGATGCCAATTTAAAGAGACGTCGTCG