Transcript Name :
Aphas_H257_00036
Orientation:
(+)
Number of Exons:
5
Description :
Amino AcidPolyamineOrganocation (APC) Family putati
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-56
117-120
178-178
239-249
310-349
434-468
80-93
141-154
202-215
273-286
373-410
57-79
94-116
121-140
155-177
179-201
216-238
250-272
287-309
350-372
411-433
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2471 bases(100 bases per row)
CTTCGATCGCGATAGGGGTGCTCATATCGAAGTTGGCGCCAAACTTCGACTTGTCTGGTTTTGCCACGGCGAGTTGTGGATTGATTCTACGTTGATCTTT
GGTCGCTGCTTGCTGCTCTGTTGACTGCGCGCCGCCACCGCCGCCGTAGCCTACAACACAGGTCGATCCCATCCCACGTCTGTACGTCATTCAGCCCTTA
CGTTCATGGCCGATACTGCTACGTCTCGTGAACGCGAGCCCATCCTGAAGCGGCCTCGGAAGCCGTCGATCGGTCGTCGACAGCTGGGCGTGCTGCCGGT
AGCGATGATCACGTACTTTAACGTGAGTGGGGGACCATGGGGAAGTGAACCGATCATCTCGTCATGCGGCCCGTTGATCGGCATCCTTGCCGTGTCCATC
TTTCCCTGGATCTGGTGCCTACCCACCGCGCTTTTGTTTGCCGAACTCTTTAGCGCGTTCCCGACCGACAGCAGCTTTTGCACATGGGTAGGACTAGCGT
TCGGTCGCCCCATGGGGTTCCACGTCGGCTACTGGTCCTGGGTCGGCGGGGTCATCGACAACGCCATCTATCCTTGCTTGATCGTCGACTCGATCATCTC
CATCACGTCCGGCGGCATCCTGGGCGTACAAGACATCAGCAACGAAAACACAGCGTTCGGGGTCAAATTCGCGGCTCGCGTCAGCATCGCCATTCTCTTC
ATGGTGCCCACGCTCTTCAGCATCAAGATCGTGGGCCGCACGATGCTCGTGCTGGCCATCATCGTCGCCATGCCGTTCGTGGTCCTGGTCGTCGTGGCCA
TCCCTCAAGTGAATCCGTCCAACTGGCTCGTCGTCAGCGAAGACGTACGTGTGTGAAAATATATATCGTATACACTTGGTACATAATTCCAATATCTGTT
GTTATTGGAATGTAGCGCAACTGGGTCAACTTGATCAGCGTCTTGTACTGGAACTACAGCGGGTTCGACGCCGCTGGCGCCTACGCGGGTGAAATCGTCG
ACCCGAAGCGGACGTATCCCCGCGCGATGGTGCTCACGGTGATCCTCATTGCCCTCACGTACGTACGCTAATGTGGTTGATCTTAATAGGTTCCTCCTAT
TCTGGTTGGACTTGTGTGTACTGCTTGATATTCGCCAAATACATGGATCGATTGTTTGTACGATGTGCAAGGGTATCCTATGTGGATACATTCACATTTG
AAGAATATGAACTACAGTTTTAACTGGTACTGGGCCAAAACCCAATACGAATCGACGATTGGTTGAAATTTCTCGTCTTCTTGAAGTTTGATTGGCTAGA
ACATCCTCTACATACATTTATCCACTTTATTCCAATTCTACGCAAAGTCCCCCATATGGGAAAAACGGAGTTTCGTTGTTTGTTCTCCATTTATTTTAGA
CGTAATCTGTATTGTGGATTCGGTCGGTACGAAATTCCAGACCCCGTCGAGTATCTCACCGCCGATCGAATCACGAATCGACGCTATTGGCTAATCCTTT
TTTGAGTGGATTTGATTGGCTCGAAAGGATAAGTATATTCAACCAATCAGCACTCCGGCGTGATTCAATATTGAGTAGACAAACCAGGCGAATGTTGAAT
TCACAATATGTGTGTAGGTACTTGATCCCGTTTGTGGCCATCACGGGCGTGGACAAGCCCCACTATGCGACATGGGTCGATGGATCGTACACGTCGATTG
CGCTGGGCGTGGGCGGCATGTGGCTGTGTGGGTGGGTGGTCGTGTCCAACTTCTTTGGCAACTTGGGGCTTTACATGGCCGAAATGACCAAAGATGGCTT
CCAACTGGCGGGGATGGCCGACTCGGGCCTGGCGCCGTCGTTCTTTGCCGTGTACGACCATCACACATATATTGTTCATCACCTATTGAACAATCACCCA
TATATATATATATTGTATGGGAGGTGTGACTGTATATATATTGACATTGTAGCCGCGACACGAGCTCGGGCACGCCGCGCCGGTCGATTTTCTTGTCGTT
TGCGATCATCGTGTTTATGTGCTTGTTTGATTTCGACACGATTTTGGGCGTCGACAACTTTTGCTCGGCGCTGTCGAGTGTCGTGGAGATCTGCGCCGCG
GTCCGCCTGCGCTACACGCACCCTGAAATCGACCGTCCTTATAAAGGTACATTTCATATATATATATATATATATATATACATTGTGGTGATAATGGTTT
TATTTTAGTCGGCCTCTCGGATGCACGGCTGACGGTTGCGATGGTCGTGCCGTTTGTCGTGGGTGTGTACATTGTCGGCAACGAGCTCCTGATCAACACG
ACCACGATGGTGCTGTGCTCGGTCACGGTCGTGGCGGGCGTGGTGCTCCAGAGGTGCTGCCTGGACGGAGTCGGTGGCAGCACCAACTGCTTCTTGTCCG
TCTAACCAATATGAAGGGTAGCGTCTATTAACACGATAATTCTTAACAACCAAGGGATTTCAGTTGTCATA