Transcript Name :
Aphas_H257_00014
Orientation:
(-)
Number of Exons:
8
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain10.413PS50222
WD40-repeat-containing domain19.855PS50294
WD40 repeat10.442PS50082
WD40-repeat-containing domain9.467PS50294
WD40 repeat10.475PS50082
EF-hand domain8.934PS50222
EF-hand domain13.509PS50222
EF-hand domain8.683PS50222
HmmSmart predictionP-Valprediction_id
EF-hand domain2.2SM00054
WD40 repeat61SM00320
WD40 repeat0.87SM00320
WD40 repeat0.11SM00320
WD40 repeat0.013SM00320
WD40 repeat130SM00320
WD40 repeat2.8SM00320
WD40 repeat100SM00320
WD40 repeat1.7SM00320
EF-hand domain140SM00054
EF-hand domain4.9SM00054
EF-hand domain0.0019SM00054
EF-hand domain44SM00054
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1426
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        5099 bases(100 bases per row)
CCGTCGGTGGCGATGGATCTGATGATGCGACTCAAGGGGGGCCAGGCATTCAAAGCCATCTCGGACGAGTTCCACGCCCGGGAGCAGATGTTGGGTCAGG
ACGGACTGCCGCTGGCCGACTTTGTCGAGATCATGCTGAAGGGCCTTCCCAAGGCCAAATCTGGCGCTGACGCGTACGACACGATCAGTGGCCTCATCGA
CTTGTTCAACGACATCGACATCAACGGCGACGGCACGCTCGAGCTGAGCGAGTTCACGTCGTACTGTGTGGACGCAGGGATGGTGGCCACGCGGGTCAAG
GTGGCGCCGCTCAAGTACCAGTACATCAAGAACAAGGAGTTCGTGGACAGGACGACCGAGGGCAGCGGCATCGAGAAGATCAAGTGGTGCCCGGTGCTCA
AGCGAGCGCTGGTGGTGGAAACCAAGGCCAACAGCGTCAAGATCTACACCTCCGACTTCAAGCAGTTCCACCAAGTGTTTGCCACGTCTGTCAACCTCCC
GAGCGCGCAAGTCGCAGACCTCGACGACTTTTCGCGGCAGACAGCGTTCACGACCGACGCCGATCTGTTGGTGCAGGACGCCGAGTTTATCACGCAGTGC
AAACTGCTCGTGATCGCCACGTCCAACTTGACGCTGGCGTTCTACGACGTGGACCATTACTCGTGTGCGATGGAGACGCAGACAACCGTGTCGCAGACGA
TGCTGCGGTGGTGTGGCGGCGCCAGTGTGCTCGCGACCACGGGCAACAATCACGTGGTGTCGCTTTGGCGGGTCGCGGCGGACAAGGTGTGTCTGGTCAA
GACGCTGGCAGCGCACCACGATGTGGTCCTGGATGTGCTTCCGATACGTGAGTACGATGTCATCCTCACATGCGACATCAAGCGGCACATTTACATGTGG
GACATCCAGGACTTCCGGTCCCGCGGCCATCTCGTGGGGCACACGCACGGCGTCCGGCAGATGGTCTTTTCGTCTGTGAACGACATGCTGCTCACAGCCG
GCTTCGACTTTGATGCGTTCGGATGGGATGTCTCGTCCAAGCAGGTAGTGATGACCCTCAGCGGCCACCGTGCGCCGCTCGTGGGCATCCAACTCGCCCG
CTTTCACACGGAGCGAGCCGTGACCGCCGACGTGGACGGGCACTTCAAAGTGTGGAACATCCACCGCCTCAACGGGTCCTCGGCGCAGCTTCTGGAAACC
ATCTCCAACGTCACGCGGTTCTGTCCGCGGTCGTTTGTGACGCTGTCCCCTCGACGAGACATCGTCGCAGGCAGCAGCGTGCTGCACATGTTTGAAAGCA
TCAAGATCCAAAAGCACGACGAAATCCCCCTTCGGGCGTTCTACCACCACGGAAGCAATCTGTTCATTGGCGTCACGGAAACATGCGTCAACTTGTGGGA
TGGCACCACGGGCGCCCTCTTGGAAGAGTTTACAGGTACAGTTCGTGCGTTTTGGGTGGGTAGTTGATGCGGGTGGTGGTGGTGGTGCAGGGCTTACAAA
GAGTCAGTTCTTGCTGTGCTGTCAAGATGCACTCAATAGAAAGCTCATTGTGGCCACGGAGGATGGACAAGTCGAAGTGTACAACTGCACCAACCTCGCC
CGCGTTCGGAAATCTACGGGCAACATTGGTACCTTGTCCACCAGACACACAGTAGGAGAGACCATCGACTGGTATATGTGTGTAGGTCGCATCGCGGCTA
TCCAGTACGATTCCATCAACAAGCTGATCGTCGTGAGCACGTTTCCGTCCACACGAGACCGCGACGACGACGAGTACGGCACTGGGGGCATCTACGTGTT
TGACGATAGCACCATCGGCGAGTGCGACTTGCTGCGGTCGCTCACAAACGTCCCGGTTGAAACGTCTAGCTTTAGCTACAACGCGTCGCTCGTCGCGACG
GTCGCGTCCGACGCCGCCGTCCACTTGTGGGACTTTGAGACGCTGCAGTTGCGCTGTGTGTGTACGCACCCGACGTCGTTGGGGCTCCATGTGGTCGCAT
TCTGGGATCCGTATCCGGTCTTGGTGGCGGCAGACAACGCGGGGAACGTCTTGTTCTTCCCCACGGCGTCGTCCCAGAGCTCTCGTCCGGACGGCGGCGT
CTTGCACTGCCTCGCCAATGCCCACGTGGCAGCAACACAAGGCGAGGCCAGCGGTATGCAGACTGCTATACACTGTCTAGTTGACACTCGGGGTAGAGGA
GTGCAGCGTGGTGACGACGCTGAATTGTCACTACGACGACGACGCTGGCACACACATGCTGGTCACTGGGGACGAGCGCGGCGTGATTTCTATTTGGAGC
CTCAACGACATGCTAGGGAGACTGCAGTTGGCAGTACGTACTACTACTTCCAATGCATGTATTCCCGAAGAGAGAGAGAGATCGACATGGCTAAGTCACG
TATAGGCCATCCCAGACACCCAGCTAAAGAGCTTGAGACGGGGGTATCATTCCCGAGGCAAATTTCACCGAGTGTATGAACCCGATAAAACCAAAACGTT
CCTCACGTCAAGTCGCCCCCACCCTCGCACGACATCGGCACGAACCACCCAGCCCCCCTCTTGCCAGCCCTGTGACATCCGTCGCATGTACTCGTGGGTC
GCACACACGGACTCGATCCACAGCATCCAGTATGCCTGCTGTGATGAACGTTGCCAAGAACGCAATGACCTTATACTGTTTGTTGCTTGGTAGACTCTGC
GAGCACCCGAACCTGATTCTCTCGACTTCATTCGACGCAACCATCTTCTTATGGGATTGGAAAGGCACGAACTTGGGTTCGTTGACGAATTTCGAGCACA
ACATCGTCGTGGCCCAGCCACCGTGGAAGTTTGCCAAAGAAAACCAAAAACGTGAGCGTGAGCGGCGGGACGTGGTCGAAGAGCTCATGAAAAAGATGGA
CCTGTCGCCCGACGAGAGGAAGCTGCAAGACATCCAGCGCCGCAAGTCCCGCCGGCCCGTCGCGGGCCATGCCATCAACCCCGTGCTCCAAGACTTGATG
GACGACAACACCCGACTGCAGCACGCCCCGCCGCCGCCGCACAAAAGTCGAAAGCGGATGGACCCTGCCGCCGCCCACGCCAACGGACGGTGCGTCCCCG
CTGTCTACATTGGCATGCCAATCAATCTGCATTGGAAGTGTAGACAATTGAGTTTGGTGCAAGTGGGGCCGTTGATAGCACACCGCGCGATGGCACGCAG
TGCGAGCCCAGCGACGGACGACTCGCCAAACAGCGAAGACACGATCGACATGGACACCAAAGTCGAGTTGAAGTCGGGCGTCCAGTCGTTGCATGCGCGA
CTGGAGATGCACCAGAACCACGAGAATTTGGTCCAAACCTCGACGAGAATGTATGTGAATTACATGGGCATTCAGCACGACAAGAGCCACAAGTCGTCGC
GCGTTCGCTGCGGCAAACTGAGAGACGTGGACGTCCACCCGTCGCCGTTTCTAAGGGAAAAGCTCGGCGCGGCGGACGTTGTGACGATGAATCATTCGGT
GTTCACACAACGACCCAACACGGCGCCGGCGCTAAAGGCGACCTCCCACTGCTTGCCGCCTTGCATGTCCAAGCACCGCCACCCGCCTGGCGCGTCCGCG
CGAGATGCAGGGAAGGTTCCGAAATCCACGAAGTCCATGTCGGCGCTTCTTCACTTGGATGACGATCCTCCAGCGGCGGCTGGCGTGTCGCCGTCCGCGT
CGACGGGCAAGCTCAAGAAAATCAACGACATTATCTTGTGTGCCACGACGTGTGCTGAGAGCGAGGATGGTGGGGACAAGACGGGTATGGTATTCTTGTG
CAACCAACAACAGGAGCTACGGCAGCGGATGGCGGCGACGCAGATCAAGTGCGTACCTTGTCGCAGATATGGGAAAATCGCTAACCATGGCGTCGTTATT
CTAGACACGACCAACTGGTGGCCCCCCATGCCACCCGAGGGACCAAGCGGGAGGCCAACCACCTGCGCACAACGCAGCAACTTGTAGAGAAACAAAAACG
AGCGAGTCGGTATTTGGCGCAAAAGAAGCGCCACGCGTCGGCCAAGATTGGGAGTGTGCTGCGGCATACGTCCATGATGATGATGCCCACGAGTCACGAA
GCAGCAACTGTGGTCAACCTCCAGCCCCGTTTTGGCATGTACTCGATCAAGGAAGTGATGGTGATCATCCGCCTCTTCTGGTCCCTCGACGTCGACTGCT
CGGGCACCGTGAGCGAAAGCGAGCTCATGGGGTGCCAGCAGTACTTTGAGAAGCTGGGCATCACAGACATGTCGACCATGTTTCGAAGCCTCGACTCGGA
CGGCACCGGCGAAGTCTCGCTCGGGGATCTGCTCAAGATCTGCTTTTTGTACGCTAGCGCCACCGACATTAAGGACATGCTCACGCTCGAGAAGCTCGGG
CGCGCGCCGGCCATGTTGGCAACCGACGCGCCGCTGACGCCCGAGCAGATCGCAGACATGCACGCCATATTTGAAGTGTTTGATCGGGATCACAGCGGAA
CCGTGAGCTTGGACGAAGTGCTGGACGCTGTGCAGTGCAAGCAGGACAACAGTTACGACCCCCCGGCGCTGTCCATGGATGAAATCCGAAAAATATACCA
AGCCAAAGACCGACATGGCAAGAAAGAGCTCGACTTTAGCGACTTTATGGCTTTGTTACAAGGCGTATACTACTCGAACAATCGCAATAAATAAAGGAAA
AACCCATTATACTCGAACGACGTCGCACAGTTGCACCATGAGTCCGTGTTGCGGAGCACAGGTAAAGTACTCGACGCCTTTGATCGTGCCGTTGTTCTTG
CCCACAGCTTCGTCAAACACGATGCCAACCATGTCACCTTTGCAGTAGTGGACGTTCCCCACAAAAGCCACCGTGCCCTGCCTAGACATAGCCACCACCA
CTTTGTCTCCGATTTGAATTGCTGCTGTTGGCGAAGTGGACGGAGCGTCGTCGGTCGCATCGCCGCTCTCATCCGACTCGTTGGTTGTGGTTGTTGTTGC
CGTCTGGGCTGCCTTGTGCGTATACCCAGCCTTCCTGCGACCTACTCGGTCTGAGATATGAGAAACTAGAGTCTTCTACATCCAGAAGTAGAGTACTAC