Transcript Name :
Aphas_H257_00032
Orientation:
(-)
Number of Exons:
6
Description :
conserved unknown protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Rab-GTPase-TBC domain31.37PS50086
HmmSmart predictionP-Valprediction_id
Rab-GTPase-TBC domain2.4SM00164
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-449
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1982 bases(100 bases per row)
AAGCCCCAAGACAGCAACCCCAACTCACATTCGCGCGAGTCAGTGCACTTCTGTCTCATGGAAAGCGAAGCGATTGGCGCCGGTAATGGAGAAGCGTCTG
TCACACCTATCGCCCCCGTACGTGGTGCATGCATGGAAGGGTCTTTCCAGCCGCTAACACTCAGGCCAGCCATGGTCCCATATGTGTGTGTGCAGCCCGA
TCTTTTATGGCTGGATCAATGATGTCATCATCCCCACTTCGTACAGAATGAAACATGCTTGACGATGCCGCGAACACGTAGGAGGCAAGCCCAAAGTCAA
ATGTGTTCAAGACCGCGTTGAAAAACTTGAGCAGCGGCACGAAGAAGGAAAAGACGAGCAACATCTTGCAGTCTGCGACAACAGGCTTCTTTGGTCGCAA
GAAGGCCTCGTCGAATCCGCCGTTGTTCCCTGGATCGGTCAAGCAAGCTTCGTTCTGCGGGGCCCAGCTCCCTCCCGTGTGGGCGACGCCTCCGCCGGCC
GTGAAGCATCTCCATCCCACCGACGACACCAACGCCAAATCGAACGACACGACGACCGTGCCGGGGCCACGCAACGCCGCTGGGAACTTGCGATCCGAGC
AATTCGCGGCCCTGCTCAAGAGCGACAAGGACTCGGTGGACTTGGAGCGCCTGCGCGAGCTGAGCTGGGGCGGCGTGCCCGTGGAGTTTCGGCCGCTGGT
GTGGAAGCTACTCCTGAGCTACGTACCCGCGCACAAGGACCGCCGCGACGCCATGCTGACTCGAAAACGCAGTGAATACCGCGACTTACTGCACCAGTAC
TACTACATCCCCGACACAGATCGCGGGATCAAGGAGCAGGAGACGCTGCATCAGGTACTGCTAGTATTACTAGATGACAGGAGTAGTAGTACTATCCTCG
TTCTGAGTACTATGTGGCGTAGATTCTCATTGACATTCCCCGGACAAATCCTGACGTGCCACTGTTTCAAAACCCGACTATTCAAAAGGTCCGATATATA
TATATATAAAATAGATATATATATATATCGTATTCCTGCTAATTTTGCATGCGATCTATAAATATATGGCGAGTTCATATATGCTTATCATGTCGACAGA
GCATGGAGCGGACGTTGTACATTTGGGCGATTCGGCACCCAGCCAGCGGCTACGTCCAGGGCATCAACGACCTCTTAACCCCGTTCGTGACCGTATTCTT
GTCATCCTTTTCTGGTAAGAATCATCCGTAAAACAACGTTAAACAACGTAAAACAACGTTAAACAACGTAAAACAACGTTGTGATCTGTATAGACGACCC
CGAACGATGTGACATGGCGACGATTTCGGACCAAGTGATGCAGGACATTGAAGCCGACAGTTACTGGTGCCTCACTAAGCTCTTGGACGACATCCAGGTA
GGTGTGCACGTATGTGTGCACCCAATTGACATGGATGGACGAGGTAGGACCACTACACATTTTCGCAGCCGGGGCTGCAGCGCATGGTGCAGCGGATGGA
GGACCTGGTGCGGCGGTGCGACGGCGACCTGCACGGGCACATTGTCGAGACGGAGCAGGTGCAGTTTGTGCAGTTTGCGTTCCGGTGGATGAACTGCCTT
CTCATGCGCGAGTGTCCGCTGGGCGCGATCGTCCGCCTCTGGGACACGTACCTGTGCGAAGAGAGCGGCTTCGAGAGCTTCCATGTGTACGTGTGTGCGG
CGATTCTCATGACGTTTGGCGACCAGTTGAAAGAGATGCAGTTCCAAGACCTGGTTTTGTTTCTGCAGAAGTTGCCCACGAACGAATGGGCTGAAGACGA
CATTGAGCCACTCCTGTCACGTGCGTACATTTTGCAAACGTACTTTGCCGACGCCCCCAACCACATTCCCCATAAATAACCAAAGAGAGTAGCAACTACT
AGGATAATAGTACGAACTGGACGACCGTGTTGACACTGTGAATACAACTATGAATAATACTATTAATAGTATTACTACGAAG