Transcript Name :
Aphas_H257_00013
Orientation:
(+)
Number of Exons:
6
Description :
predicted protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
DnaJ domain1.5PR00625
DnaJ domain1.5PR00625
DnaJ domain1.5PR00625
Profile scan predictionP-Valprediction_id
DnaJ domain15.474PS50076
CAP Gly-rich domain13.406PS50245
HmmSmart predictionP-Valprediction_id
DnaJ domain2.8SM00271
CAP Gly-rich domain1.7SM01052
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
DnaJ domainIPR001623
CAP Gly-rich domainIPR000938
*** None ***
InsideOutsideTMhelix
1-296
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1359 bases(100 bases per row)
GCGATGTCGGTTGCAACAGCTTACAGGTGAGTGCCGCCGCCTGCATCGAAGGGTATGGACCTACTTTCCCTGACGAAAGGACGTAGAACATTGGGCCTAG
CTCCGGGTGCCAGCAGCGATGAAGTGCGTGTGGCATACAAGCGCTTGGCATTGCAGTACCATCCAGACAAAAACCGAGCTGGCGTCGACACGACCGAAGT
GTTCCAGCGCATCAGTGCTGCGTACAAGCACATATCTGACACTTCACAGAATCAACATGAAGGAGGGGGCAGCATGGATGATGGTGATTTCGACGGAACA
GTGCCGTTTGACGAGTTCATGCAAATGTTTGAAGCCATGTTCCAAAACCCATCGATGAGTGCCTTCCGAACCAAGAAGAAGGCAAAGGGCAAGCGACCAG
GGATGCGGCGGCGAGGCGGTGGACGCCCAAGGATGGACTTTGACGACATTCTCTTCGCCGGAATGTCTGCGTTTGGCGGCATGTACGTGCGTGGCATAGC
GTCGTCCGTGATTCGATCGGGCTTTGTGTAGGCAAGACAGTCAGAGCTTCTTCGATGCCATGCCTGGCGAATCGTTTGGTAACTGCCACGTGTCCAGCGT
TTCAGTACTCATGTTGTCGTATAGACGACAACGATGACGACGAATTGAGCGCACTCTTTGAAGAGATGGCCCGCATGCAACGCAGGTACCACCTACCATC
AACACCTACACCCTCCTCCCTCACACATGACGTCTAGGCCAACAAAGTCCAAATTCCGATCTTCGAGTAGTAGTACTCTACTTCTGGATGTAGAAGACTC
TAGTTTCTCATATCTCAGACCGAGTAGGTCGCAGGAAGGCTGGGTATACGCACAAGGCAGCCCAGACGGCAACAACAACCACAACCAACGAGTCGGATGA
GAGCGGCGATGCGACCGACGACGCTCCGTCCACTTCGCCAACAGCAGCAATTCAAATCGGAGACAAAGTGGTGGTGGCTATGTCTAGGCAGGGCACGGTG
GCTTTTGTGGGGAACGTCCACTACTGCAAAGGTGACATGGTTGGCATCGTGTTTGACGAAGCTGTGGGCAAGAACAACGGCACGATCAAAGGCGTCGAGT
ACTTTACCTGTGCTCCGCAACACGGACTCATGGTGCAACTGTGCGACGTCGTTCGAGTATAATGGGTTTTTCCTTTATTTATTGCGATTGTTCGAGTAGT
ATACGCCTTGTAACAAAGCCATAAAGTCGCTAAAGTCGAGCTCTTTCTTGCCATGTCGGTCTTTGGCTTGGTATATTTTTCGGATTTCATCCATGGACAG
CGCCGGGGGGTCGTAACTGTTGTCCTGCTTGCACTGCACAGCGTCCAGCACTTCGTCCA