Transcript Name :
Aphas_H257_00038
Orientation:
(-)
Number of Exons:
1
Description :
chloroplast Toc64-2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat-containing domain6.734PS50293
Tetratricopeptide repeat-containing domain12.494PS50293
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat1.5SM00028
Tetratricopeptide repeat72SM00028
Tetratricopeptide repeat32SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-191
NN-scoreoddsWeighted Score
0.9095.9020.012
*** None ***
TypeScore
nuclear739
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        761 bases(100 bases per row)
AGTATACCTTATCTGATTTGTATTCGACACCTGCGATAACATCCGTGAGTCGATGAATTGGCTATGGGGGAGCACAGAAAGCGACGGAAGCGAGCAGTTG
CCGATTGGTCTGTCCAAGCTGAACCGATCGGGTCGAAACATTCCCACGGATGAAGACGCGTCGGTGCATAAGGACGCAGGGAATGCGTGCTTTAATCGCA
AGGACTACGAAGGCGCGGTGTATCATTACACAAAAGGTCTAGTGGAGAAACCGACGGCCACGCTCTTCAGCAATCGATCGGCGGCGTTCTGCGAGCTAGG
CCAGTTCCACAAAGCGTTAGCCGACGCCGAGCAAGCAGAAAAGCTGGATCCCATGTGGGCCAAAGTGTTTTCGCGCAAAGGCAAGGCCGACTACGGTCTG
AAGCAGTACAAGCGAGCGGCTGACGACTTTGCCAGAGGCCTGTCCTTGAGCATGCAGTTCGCAGCTGAGGAAAGCGTGAAGCGCGACAAGGAGATCGAAG
CGTTGACGCGGCAATCCAGCAACCACACCGAAGCGTACTTGAAGCTCTTGGACGAGAACGCCCAACTGCGCCGCCAAATCGACGACTACAGACTCATGTT
TGACGACTGGGCCAAAAAGCAAATGTAGTCTAACACGAACTCGATGTTGATGCCGTTTGTTGGTGCGGACATTTCGCAAGGGTAGGGGTGTCAAGTTATT
GAGCTATGGAATGCTACGGTATATCCTAATGGATACAATTGAAGTCAAGTTTGATGTGTGG