Transcript Name :
Aphas_H257_00057
Orientation:
(-)
Number of Exons:
8
Description :
calcineurin-like phosphoesterase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
5'-Nucleotidase/apyrase1.73528PR01607
5'-Nucleotidase/apyrase1.73528PR01607
5'-Nucleotidase/apyrase1.73528PR01607
5'-Nucleotidase/apyrase1.73528PR01607
5'-Nucleotidase/apyrase1.73528PR01607
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-509
NN-scoreoddsWeighted Score
0.5952.6070.005
*** None ***
TypeScore
cytoplasmic435
GO
Biological ProcessGO IDPrediction Method
hydrolase activityGO:0016787IEA
nucleotide catabolic processGO:0009166IEA
KO ID
K01081
K01081
K01081
*** None ***
Sequence
        1954 bases(100 bases per row)
GTAACTGGCACAAATCAACATGACCGTCACCACGGCGACGCTGACCTTCCTCACCGTCAACGATGTGTACGATGTCGTGCCCAACGAACAAGGACGTGGA
GGTACGCGTAGATGATGCACTAGTGTATGTTCCATCTGACGTTCGGGATGTGCAGGTATGGCGGAGCTAGCAACGCTTCTGCAAGCGGAGCGGGCCATCA
TCCCGTCGACGCACCATACACTCACGACAATCAACGGTGACTTTCTGTCGGCATCTCAAGCAGGCGAGCACTACAAGGGGCAATGATCCATGTTGCATGT
ATGTTTCCGTTCATGGATCATCACGAGTTTATGTAGAGCCCATATGATTGACATTTTGAATCGCATGGACATCGACTATGCAGTCTACGGTACCACTGGA
TGCCGCCTGTTGTTCATCATGTTCAGGAGTGTGTAGGAAATCACGAATTCGACTTTGGCTCGGACATTCTTGTGCAGCGAGTGGCCGAGTCCAAGTTTCA
ATGGTTTGGGTCGAACGTCCGCGACAAAGCGACGGGAAATGTCCTCGGCAATGGCTTGGACACGACTCTGTTTCCCATTGCATCTACCGCGCAAGGCACG
TTGTCTGTATACCGAGCACTTGTGCTCAAGGAATATTCCCATAGATGGGGCGATTCAAGTGGGAATGTTTGGGATTTGCACCCCCGAAACCCCTCAATTG
TCCTTTCCGGGCGATAAGGTCGAGTTCCAGGACATCTTGGGCACGGCCAAGGTAACCCCATAAAGCTCCATATATAGTGTATTTCAGCGAGGAATCTCCA
TGTAATGTAGCGTTGCGTGGACGACTTGAAAGCCCGCGGGGCCGATGTCATCATCGCGTTGACCCATGTGAGCATCGCCCACGACAAGTTACTGGCCAAG
CGCGTACCAGGCATCGACGTGATCATCGGGGGGCACGACCACGATCCGTTCACGATGTACCAAGGCAAAACATTCATTCACAAGTCGGGGCAGAATGCAT
ATTGGTTGGGTCGACTGGACTTTGACATTCGGAAGGCGAGCGGAAAAGTGACCGTGTCTCCAGCATGGAAGATGATTGCGAATCAAAACGTCACCCCCGA
CGCTGGCGTCGAAGCTCTGGTACGATCGTTCTCGTAGGAATGTACAAATAACAGGGAGGGGGTCGTTAGGTGCACAAGTACATGGCCCCGTTCATGACGG
CGGACCACTTGGAAGCTGGCGCGCGGCAGTTGGCCGTGCTGAGCTTGCCCCTAGTCACAAAAACGTCGGTGATGCGCGGCGAAGAAAGCAACTTTGGCAA
CTTGGTCGCGGACGCGGTCCGGCAAGAACTTGGCGCGCAATTCGGAGTCCTCAATGGCGGCTTTGTTCGCGGCGATACAGGTCTGTCGGAGATGATAGAG
TCTGAAGCAGGAACGACAAGCATGTGTCTAGTCCATGAAGCCAAATCGCAGTTGACGGTGGGCATTGTCCTCAAGGAAATGCCGTTTCCCCGTCCGGCAG
TGTTGCTTCGCATCCAAGCGCGGGATTTGAAGGAGGCGCTGGAGCAACATTTGAGGCACTACCCGCTGCTGTCTGGATCGTTTCCTCACGTGTCAGGGTT
GCGATTGACGTACGATCGAACTCGCAACACCCCCGAGGTGTGTTAGTTGTCGCAACTCCCACCGAGATGTGTTCATTCTGGTCGTAGATCACAACATTTC
AAGACGAGCTTGGCAACAACGTCGACCTCGACGACTACGTCACCGTGGCCACGACCAAGTTCATTGCCGGCGGCGGGGACGGCTGCGTGTCATGGAAGAA
GGCAACGCTCCTCGCTACGGACGACACTATCGCTCAAGTGGCCATCCGATTCCTTGAGAAGAAGCGCTTGATCGCATACCCCGAAAAGGAGGGCCGCGTG
ACAATCGTTGATTAAGTGCGACGAGAAATAAAATTACAGAGGTTTTCGAGAGAA