Transcript Name :
Aphas_H257_00007
Orientation:
(-)
Number of Exons:
1
Description :
heat shockprotein A
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Heat shock protein 70 family3.3PR00301
Heat shock protein 70 family3.3PR00301
Heat shock protein 70 family3.3PR00301
Heat shock protein 70 family3.3PR00301
Heat shock protein 70 family3.3PR00301
Heat shock protein 70 family3.3PR00301
Heat shock protein 70 family3.3PR00301
Heat shock protein 70 family3.3PR00301
Heat shock protein 70 family3.3PR00301
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat7.729PS50005
Tetratricopeptide repeat-containing domain18.625PS50293
Tetratricopeptide repeat5.045PS50005
Tetratricopeptide repeat10.709PS50005
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat13SM00028
Tetratricopeptide repeat21SM00028
Tetratricopeptide repeat5.8SM00028
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Heat shock protein 70 familyIPR013126
*** None ***
InsideOutsideTMhelix
1-787
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2524 bases(100 bases per row)
ATTGTGAACTGAACGATGGCCCCTCCTCGCCGCCGCGCCAACAAGAAAGCTGGGTCTGACTCCTATGCAAACCTTTCCGCCGATGAGCGCAAGCAGCAAG
GCGGTGATGCCAAGACCCGAGGCAATGCTGCCTACAGCTCGGGCGATTTCGCCACGGCCATCAAGGAATTCACCACGGCCATCGCTTACGAACCCCACAA
CCACGCTTACTTCTCCAACCGATCGGCTGCTTACCTGAACAATGGCAATGCTGCGGCTGCTTTGCAAGACGCCAACAAGTGTATCGAGATCGATGCCAAG
TGGAGCAAGGGTTACGCTCGCCTCGGTGCCGCGTACTACTACGTCAAGAGCTACGAAAAGGCCATCTCAGCCTACACGAAGGGATTGTCCCTTGAAAAGG
GCAACAAGCAACTCCAAGCCGGTTTGACCCAAGCGCAAGCAGCTCTCCAAGTTCTCGAAGAAGAGCAGAGTGGTGTGGATATGGACGACGCCACGCGCAA
GTTGAAGCGCCTCGAGATCGAAGAAAAGATCAACAAGGCCCGCGCCGACCGCGAAGAAAGCGCCAAGCGCGCCGAGCGTGGTTTCTCGGAGGTGATCGGG
ATCGATCTCGGTACCACCTACTCGTGCGTGGGTGTGTGGAAGGACGGCCAAGTGGAAATCATTGCCAATGCCGAAGGCAACCGCACGACCCCTTCGTGGG
TGGCGTTCAACGAAACCGAGCGCTTGATCGGTGAAGCTGCTAAACTTCAGGCCGCGTCCAACGCCACCAACACGGTGTTCGACGCCAAGCGTATCATTGG
CCGCAACTTTAGCGACCCCATCGTGAAGAAGGACGCCGCGCACTTCCCCTTTAAGATTACCAAGGGAGAAGGTGACAAGCCGTTGATCGAAGTGTCTTTC
CGCGGCGAAGCCAAGAGCTTCACCCCCGAAGAAATCTCGTCGATGGTGCTGACCCGCATGAAGGAAACCGCGGAAAACTACCTCGGCCAAGAGATCAAGC
AAGCCGTGGTGACCGTGCCTGCGTATTTCAACGACCAGCAGCGTCAATCCACCAAGGACGCCGGCGCCATCGCTGGCCTCGACGTGAAGCGCATCATCAA
CGAGCCCACCGCCGCCGCCCTCGCGTACGGCTTGGACACGAACGCCGGCGCGGAAGGCAAGTCGAACATTTTGATCTTCGACTTGGGCGGAGGCACGTTT
GATGTGTCCATCTTGTCGATTGAGAACGGCATCTTCGAAGTCAAGTCCACGGGCGGTGACACGCACTTGGGTGGCGAAGACTTTGACTCGAACATGGTCG
ACTACTTGATCACCGAGTTCAAGCGCAAGAACAAGAACTTGGACCCGACGACGTCGGCCCGGTCCATGCGCCGCCTGCGCACGGCGTGCGAGTCTGCCAA
GCGCATGCTTTCCACGACCACCAGCGCCACCATCGAAGTGGACTCGCTCTTCGAAGGTGTGGACTTTAGCTCGACCATGACGCGCGCCAAGTTTGAGTCG
CTCAACGACGAGTGCTTCAAGCGCACGGAAGAAACCGTGTTGAAGGTGTTGCAAGACGCCAACATGGAGCCCGGTCAAATCACCGAACTGGTGCTCGTGG
GCGGGTCCACGCGTATCCCCAAGGTGCAAAACATGCTGTCGGGTCTGTTTGGCGGCAAGGAGCTGAGCAAGTCCATCAACCCCGATGAAGCCGTGGCGTA
CGGCGCGGCCGTGCAAGGCGCGATCCTGAGCGGCATCCGCAACGACGCGACCAACTCGTTGTTGCTGGTGGACGTGACGCCCTTGTCTCTGGGCATTGAG
TTGGTGGGCAAGGTCATGTCGGTGCTGATCAAGCGCAACACGGCGATCCCGGTCAAGAAGACGCGCATCTACACGACCGAAGAAGACTTCCAGACCACGG
AAAAGGTCGTCATCTACGAAGGCGAGCGCGCGTCGGTGGTGGACAACAACAAGCTCGGTGAGTTTGAAATCACGGGCATCGAGCGCGCCAAGCGCGGCGA
GCCCAAATTGGAAGTGACGTTTGAGATCGACGCCAACGGCATCTTGCACGTGAGCTGCAAGGACAAGAAGACCGGCGCCAAGAACCAGACCACGATCAGC
AACAACCGCGGCCGGTTGAGCCAGGAAGACATTGACCGCATGGTCGACGAGGCGGAGAAGTACAAGAAGGCGGACGCTTTGCTGTTGAAGCGCATCGAAG
CGCGCAACGAGTTGGAAGGGTTCATCTACCGGTACCTCGAAGTGGCGACCAAGAAAGGCGAAGCGGCCGCTGAAAATTTGCTGCGAGAAACCCGCGACTG
GTTGGAAGACCACACCGAAGCCACGGTCAAGGAACTCGAAGACAAGAAGCGCGCGTTGGAGCGTGTGTGTAGATTTTAAACCCACGTGGAATGCAATCGT
TCTCGTCCTAAACAAACAAAATCGACCGTAACGTTTCTCAGACCACTCCGAAATGGGCTCTTTTGTTTCGTTGGACACGTGATACAAAAGCTCGTCTAAC
TGTAAACACATGTGGGCCTTGCGC