Transcript Name :
Aphas_H257_00034
Orientation:
(-)
Number of Exons:
18
Description :
transmembrane protein putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-366
416-475
557-583
659-807
899-1074
390-392
499-533
607-635
831-878
367-389
393-415
476-498
534-556
584-606
636-658
808-830
879-898
NN-scoreoddsWeighted Score
0.632.4650.005
*** None ***
TypeScore
endoplasmic reticulum778
GO
*** None ***
*** None ***
*** None ***
Sequence
        7574 bases(100 bases per row)
ATAAGTTCCTGTGAGTCCAAGATTTTTTCACGGCCCAAGACCGACTCTTCCGACGAGGATCTCAGTGATAAGGAACCCATCGTCCGAACGCATGCAGTCC
AACAACATCGCATCGTTGGATGTCGTCAGGGCTGCTAATGTCCAAGAAGATCCTGACCTGGAACAATCCGAATCGCAAGCCGATGGCGGGTCCTACGCCA
TGATGTCGAGTCCATCTGCAAGCAGCCTGCGCGTTCGACCACCGTCGCGAGGATTTGCTACTGGCGGGTCCAACCATCGTGCCAAACGATCAGGTAAGTC
CTCCGCCTCCCCTTCACCCATTCATATGCAACAACTCGTTCCATAGGCAATAGCTCCAACTCGTCGTCGTTTGGACCTTCGAAAGAACGCGGTGGTGGAC
CTGTCGTGACTGAACTCCAGGACTGCATCATGTATTCAGGTCATGGTGGTGCGGGGTTTTCTTCGGAGAAAGGCGACAAAGATACCAAGGACACGCTTCG
TGCGTCGTACCATGACCTCAGTGTGCCCACCGTCACAATCCCCGAGACGCAACGGTGCGATGCTCTTGCTAGCTAGGCTCGTCTAACAAGCTCTCGTCGT
TTTGCGTACAGGTACACGTTCGCGATTGTGCTGCGGAATCGGTACCAGGTCAAGGACATCTTGCGCGAGCGCTTTCCCGGAAAGGCCATGAAGGCGACGC
GGCACCGCTTAGCCGACCAGGTGGCCGCCATGCATTTGAAGTGCTTGCGCCGGCTCGTCCAAGCCGGCCTCGGCGTCATCTTGCTCGACAACGACAACAG
CATCCCCCACGAGAATCAAAAGTACAACCAGACCAACAACATCTGCGTCCTCATCGATCCGTACAAGGTATCATAGAGTCATATTTAGCATCATGTCGGA
ATCCACACTAACTTAATCGAATCCCGCGCTGCTTCTTTCATAGTACTTAGAGTTAGTATTGTGCAATTTCTATGAAAGTTGCCAATTTGGGGGGATTACC
TAATCGACCAAAGGAGGAGTATGATTGGCTACAAAGAATGAAGATTGCAATATGATTGGCTAAAAATATTGATTCATGCATTGCAGTTTCAAAGATACCC
CTTGAACTTAGTTTTAAATGAAATTTCAAAGGTCTGGCGATTGTTCGGCGGTTCATTCAACGAACCGCCAACGGAGCAAATTACAACATATTGGTAATTC
GATTTCCCAGTCAAATTGGACTGGGGCTGCCAATCGCAAAATCGACGAAGAAATCGACGGACGAAAGTAGCCAATGAAATTATCCAAGCAAAATTGCTGA
CCAATCAAATTGCGTGATATTTGCCCCACTTTTCCATTTCACAATGAGAACACGAGTTGGGAATTGTATGGTATACTTCGTTGAAGTAAAAAAGACGATT
TGACGAATCTACCGAAAATATCAAATTTAGCTTGAAAGCACAATACAATACAATACTAAATAAATATAAAGCCAATACAATACAATACTAAATATATGTC
GATCACATATCTTGACCAGACTTGGTATATTTTGACTCGTGTGTTTCCATACCATAGGACAGCGACTTGCTCCTCCAAGAGTTCAAGCGGGAAAAGGACG
AACTGGCGATCAAGAGAGGCCAAGCGAACGCGCGATTGGGCATGGACACGATCGAAAGCGTGAAAAATATTTGCTTTTCCCCGGCGCTTGAGCTCCAACT
GACGCACAACATTATCCACAACGCGTTTCGCGACTGCGACAAGGACGACTGGGTACGTACTGTTTTTATGCCCTTACTTCTTGTTTCATTCTAAATTGGT
CATCTTGTACGCTTTGGTATGGCAGGTTTTGTATACGAATTCTAATGCATCGCTTATATAACGGTATAGGATAAGAATCCACGATCGATTCTCTGTTGAT
CGTATGTATATATATATATAGACTTGGGAGAGCTGTATTACATGTTGCATCCGATACAGACCCTGGCCTAAAGATTTTTTATAATAAACTCGAAAATAGT
TTTTTTTATATTTCATAATTTAAAAAAACTTCATTTTTTATTTGTTCCCTTGATCGATCGTGATTGGTTGAACCATGCATTTGCTGGACGCGGATTGGCT
AAATCAGATGGCGACTCGACTGTTTCGACTGAACACAACAATATGTATATATATTGAAATTTTATCACCTTATCTGATGAATATTTGTGTAGGGCATCGA
ACACCAGCAAGAGCTGACGTGCTGGGACGTGGTGGACACGTGCTTTCCGCTACACGACCGCGTATTCAACAACGCGTTCTTTGCAGAGTACCGCAACAAA
ACGTTCGACTTTCGCGTGAGCAAGGCCACCACGGGCAACTCTGAGCGATGGGCTATCGAAGGTATATATATATATATATGCTTGATATGACAATGTTGGA
CCAGTCGATTATATATATATATAAGACAAGGTTGGGGGCGACTGAGATGGTGTTGTGGTGGATAGAATTGCGGCTGCATTTCGGCGAACGCGTGGCCTTC
TTGTTTGCTTTCATGCACATTTACAGCAAAATGCTGGGGCCGCTCACGGTCGTGTGCGTGCTCTACTATGTCGGATTCCGGTACTGTACTATTTGCAATA
TATATATTGTGCTCTCTGCCAAAATTGGAATATAATCATTTGTGCTGATTTTTTACATCCATCGGTCGGTTAATATTTGTACTGACTTTTGTATGTGAAA
TTGTAAGCCATTCCCCGAATGTCAAGCCATATTTTCATTCTGATGTTTGCCCGAGTTGGATTGGTATCATGTCAAAATGTGTGATATTTATTTACTAGTA
CCTTAAATATCTATTAAAAGTATGTATAGTTCAAATCCTAAATTTTGGCGGTCAAAAAGTACATATCTGTCGAGTTGGTTTTGTGCGTTTATATTCGATA
AACAGCCTCCAAAGTGGATACAAGAATCGTAGTAGTCTATGAAATATCATTCCATATTTCGTGTATTGAATCCCATCCATAGGATGTAGTATATCTTTAA
ACAAATAAACAAATGAATATATATATATATATATACTCACTCGACAGTGTTTTTCGGGACTAGTTTTGTACAGGGGTATGTGTGGAACTACTATTTGCTG
GGACTGGCGGTGCTTGGGTTTGGCGTCGTGAGCTTGTGGGCGCCTGCGATGCTGCTCGTGTGGGAGCGCGAGACGCGAACGTTGACGGAGAAGTGGAACC
TGCAAAACTACAAGGACACGATCTTCGAAAGGAACGACGAGAACCCCAAGTTTGAGTACGTCTGGGCCAAGAACGAGCTCACCCACGAGATGGAAAAGCA
GCCCAAGAAGTCCAAGAAGCGCCTGATCCGAGTCACGATGCTCTTCTTCGTCGCGCTCAGTTCGATCGTGCAGTGTATCATCCTCATGCCGTTCCTCCAG
GTGAGATCGATGGGATGTTGAACGATGTCGCATGTGTATTTGTAGTGGTACGTGTGGTCCAAGTTGGCGCCTACGTGCGACAGCGACCGATGCAAAGAGA
TTGGGTGCCTCCAGTTCCTCAACTGTTTTGCATCGGCCACGTCCACAGTGGGCACGGATCGCTGGGCGTACATTCTGTGCCAGGTATAAGCCAAAAAAGT
GGACGTTTGTACGAATGTGCCAAATCCAAAATTGATCATTATATTTAATACTGAATTATCACACTAATTGATGAATTATCACACTAAGTCACACACGAAT
GAGTTGTTTTGATTGGTGGACGTGATGATGGTTTCTTGCAATGTGATTGGCTAAATTATTCTGCCGAGTTTTCTGTACATGGTTTGGTTGTGTGTCGATA
ATACATACATTTACCACGTTGCTCCAAGTTTGAATATAAACACAACCATACGGACTTGAATTCATGTTGACGTTTGAATACTGTACCTGTGGACGAGTCC
CATCACACTAATTGGTGTCGTCGTACACCAATTGCAGGATGTTGAGTGGGCTAATCGACAATACCGAATTTGCGACATACGTACATACAATACGAAGAAT
CATTTACTGGTTCATAGAGTATATACATACTCCTTGTGGGATTCTGACCTATGTACAACTGGGTTTTAGATTTCTCATCCCCAATATATATATATATATA
CTTCGAAGTATGTATATACGTTTGCATGGCGTGTATATGTATTTAAATGTATTTGTAATATTGTCCATTTACTCAAAATGTGGACGTGTGTGCTGATAAT
TCGCCAAATCTATCGATCAATTCTTTGTATTGACTTTTCTATGTAAAAATCGTCCAGTGTCACACTAATTAAAAGTCACACACTAATTCGATGTTGCATT
GGTCGAAGAGTGGATTTGATTGGCTACTTGATTAGTATTCTGGGTTTTGATTGGTCAATCGATTGTCTGCCGATTTGGTGCTGCGCATGGAGCACCCCAC
TCACTCCAATTTCGAATCGAATATCTTGACAATATATGTTTGAGAAATGAATCCTAACAAGACATTTATATATATATATTTGTAGGGCGTGATCTTGGGG
TTGTTGATCGACACGGTGTTTTACGAGTTTTTCAATTGGTTTTCGTCCAAGTTTGTGCAATGGGAAAACATCCGCAAGAAATCCGACTACGAAAACCGTA
CGAATTCATCCATCTATATATATATATATATATATATATTCAACTATGATAATTCCATGTAGGGCTAATCCACCGCAAGTTTGTGTTTGTGTGGAGCAAC
TGGTTCTTCTGGTTCCTGACACTGGCGTTCCTGTACCTGCCCTACGGCGGCCGTGTCCAGGACGTGTATCGGTTCCTTGGGATGGAGTGGGCAATCGTGT
ACAAGTGGAACCCGACGCTGCTGACACTCGACACGCTCTTTGTGACCCCGCTGGTCGTCACGCAGCTGCTCAATATGGTGCTCGAGACGTGGCTGCCGTA
CGCCATTCGCGTCGTGAAAGGCAAGCCCATGAGCTGCCGCAACTGGACTTCTACGTGGATGGCCAGCTTTGACGTACGATCGATCCGATTCAACCATGCA
TATCTGTTGGGGATTGTTGTGAATATATATATATATATATATATCGCAGCCACATATCAACCATATATATATATATATATATATGGTTGATATGAGGCTG
CGACTGAATCAAGTACATTGGATCGATGAATGAATGGGGGCTTCGTTGTGAGTTTTACTTGTATGTACAATATGTACGTAGAGGAGCGGATATGTCTGTT
TGTAGTTGGTGGACCTGGTTATCACACGTTGTGGTTAGAGATATATTGGTGATTTTATATACTATATATGTTGCATTGGTTGGTAGTGACGGATATATAT
ATATATATTGCATTTCGCATGGGTATTGTCGTTGTAGGTATTGGTTGTGTTTTGATATGTATCATCGGTTGTGTACGTGTTATATTATTTTTTATTGTAC
ATGTATGTAGTATATATTGCGTTGTTCTATGTGTATAATATATGAACATGTCGTGTTGAATATGAATATGTATATTAGTGCATCAAGCGACGAAAGGCCC
GGAAGCGCAAGCATCGCATGGACACCAACATGGCGGCGCACAAGCTGGCGGACGACGTCTCCCGCACCACGCGCTTCTTCGTGCCCGTCTTGGGCTACTC
GGACGACTCGAACGAGTACACGGCGTACCAGGTTCATATATATATAAATATATTCACATAATTATATATTTTTGTTTGTGTAGATATTGGCCGAGTCGAA
GCTGCCTATTTTTGACACGAGCTCCGACTACTTGGACGCGTGCATTCAGTTTTCGTATATCCTCATGTTCACCGTGGTATGGCCGCTGCTGCCGTTCCCA
GCCTTTTGCAACAACGTGTTGGAGGTACTAACTAGTATCCTTCTTCGCTCTTGCCAAAATACTTTTCAATCCATACATATCAACAACCTGCATATGATTG
GGTTATGATCGTCCTTATGGATATATATATATTAACGTGCATAATGGGGTAGGTTCGAGGTGACGCATTTCGGTTGCTGTTTGGCCACCGTCGGCCCATG
CCCCGCCGCGATGTACGTTTCATTTTATATTATGAATCCATGTATGACGGTGTCACAGGTATCGATTGGCGAGTGGGCGACCGTGCTGCATTACGCCAAC
GTGATGGCCATCACAATCGTGTCGGCGCTCCTCGTCATGTATGTGTAAATTTATCTCCATAGTTTGGTATCTCGTTGGTGTTCTAAATCGATCGACGGTG
TTATAAATCTAAATGTTGTTACGTTATACTGAATTGTCCAGTCATATTGACCATCACACTATTTTTGTTTGTCATACACCAATTGCATGTTGATTTGTGC
TTTTCTGCAAATTCGGCTCTTCTTGCCATTGTTGGTTTGGCCTGTACAAAGACTATTGTTGATATTTGTCCAGCCAATCGATTTTTGATATGCGACTAAG
GGTACATCTGTAGTACAAAATGGGTTAACCAAAAATATACATTTTCAAATATATATATATATTTATGATTTGGAGTGAATTCCACACTAATGGCATTTGG
GGCCAATATATAGTACGATTTCAGGTTTTATCAGTCGCCCCCTAATGTATCATCTCACAATAACGTGGATAACTAACATAACTGGGTGGTGGTAGGTACC
ACTTTGGAGCGTACGCGAGTCTGAACGATGGCAATTACTGCGACTTTATGTTTGCAGATGCGTCCATGGTGCCGTTCCAAAGCATCGACTTCCGCGTCGC
GCGGTCCAGCGCCAAGTGTCTAGGCATGCGGGACCAACCATGGTTCAAGCACCAAGTGCTCATCTTCATTGCGTTGGAGCACATTGGGTTTGGCTTTCGG
TATCGCCAACTAGTAGTACCATTAGTACTAATACCAGGATTAGGTACCTCGTGCTGCAAATGGACAAGACGCCAACGTCGATTTCCAACCCGTCGTACCT
TCGTCTCAAGCAAATCCGCGAGCTAACGTCTCAGCGCACGGCGCACTCTGGCGTGTTCAATTACATTGGCGAACTTCGGCTGATATTTGACAAGTACGAC
GTTGATCGGACCGACCACCTCGGCGAGCGTGACCTGGTGCTGTTTCTGGCCGAGTGGATGTCGAAGGACCCGGCGGAGCTGCAGAAACGGTCGAGTCTCG
TGTTTCGATACATGGACAAGAACAAGGTGGGCAAAGTGCCCTTCTCCACGTGCTGTCTCATGCTCCAACATGCGCATCTGGACCGGTTCTTCTCGGCGCT
GCTCGGTATTTACGACCACTTGGACGACCATCGCAATGTACGTACACTCTGTACGACCATCATTCCGACACACCCTCTTGTGATTATAGCAAGAAGTGCG
ATTGAACTGCGATGATCCAATGCGCATTCGACGGGTGCTGCGGGCGCAGTCGCTCGAAGACCACCACCGCGTACGGGAAATCCGATGCCGAATATTCATA
TGATATATATCTAATTGCCGAATATTCATATATATCTCAATAGGAAAACCACCCAACCCACGACGATAGTAGTAATATTCGTTTGACCCCCATGGCCGTC
GCCAGCATCTAGCCTACCCAACCCTATCCAAGTGGCTGCATTTGAATATATATATATATATCATATACTTGAAG