Transcript Name :
Aphas_H257_00018
Orientation:
(-)
Number of Exons:
24
Description :
Chloride Channel (ClC) Family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Chloride channel, voltage gated1.05594PR00762
Chloride channel, voltage gated1.05594PR00762
Chloride channel, voltage gated1.05594PR00762
Chloride channel, voltage gated1.05594PR00762
Chloride channel, voltage gated1.05594PR00762
Chloride channel, voltage gated1.05594PR00762
Chloride channel, voltage gated1.05594PR00762
Profile scan predictionP-Valprediction_id
CBS domain8.955PS51371
CBS domain8.221PS51371
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
144-162
245-264
330-353
414-455
528-533
1-120
186-221
288-306
377-390
479-504
552-790
121-143
163-185
222-244
265-287
307-329
354-376
391-413
456-478
505-527
534-551
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
voltage-gated chloride channel activityGO:0005247IEA
membraneGO:0016020IEA
chloride transportGO:0006821IEA
*** None ***
*** None ***
Sequence
        4623 bases(100 bases per row)
GTTTCGGTCAGGTGCATCCACTGCAACTGCAACAGTTGTCGTGGCCGATTGATTGGCATTGTTGGTCTTGAATGTCACTGCCCCAGAAGGAACCAGCGGC
GGGGGACACGTCAGGCCGCCAGGGTCGGATGTCTGCGTTCCACTTCTCAGCTGTCAATGAGATCGTGTCGCCTGTGCTTCGTGACGACCATGACGAAATG
ATGTGGGAACATCAAGGTATGTACTGTACATCAACGATGCACATGCCGTCGGTGGCCTCACGTGGGTATTGTGGGCTTACTGAAACACGGTTGTTAGCCC
TGACGCCGTCGTTCGAGTTCAATAACGCTGCAGGTCGGTTGCGCTCCCGACGGAATAGCTCCCATTTGCTGCGGTCGACGTCGTATTCTGGCCAAACGTA
CGGCACTTCCGGGTACCCCTTCTCATCAGCATATTGTCACTTAGGAGGTCTTATGTGTAGGGAATCTGGAGACCTCGACGCGAGCAAGGACATCACGTTG
TTCGATGGCGAGTACCATTCCATCTATGTGTCGCCCGCCCCCAAAGGTACACACACACATCTCACGCATCATTGCCATTCACAACCGCAAGTAGGATGGA
GAGGCATCCTCGTTCTCCTGCAGAGTCCCATCTTGCTCGTGTGCATTGGGATTTTCGCAGCTTTTCTCGGGTAATGTATATATATATATATTTGTTTATA
TTTATCATAACTGGGCAGGCTTTGGATGGACGCCATGATTTTACGCGTGACGATGTTTCACCAAGAGCTAGCGAGTCTCGGGTACTGTGCTGCTATGTTT
TTGTTGCTCGTATATCCAATACTGTTATAAATATATATATAATTAGATTTTTTGCATTTTTGATCTTTTCGTTGGCGATGGGTGGCGTCGGCACGGTATG
TTGATATATATATATATATGATCCTTGCTGGATGTGATTTAAATATATAAACAGGTGCTCGTGCATTTCGTGTGCCCACAAGCAGCTGGCTCTGGCTTGC
CTCAGATGAAGGTGGCTCTCTCTGGTAAGAACTTCTTCATGTACTGTATGTACATCATGCTTAACGATCACGGGGTGTGTTAGGCGTGGACATGCGCGAG
TACTTGAGTCCGACGTGCCTCATGGTCAAGATGGCAGGCTTGGTCACTGCGTATGCTGCAGGTACTGATGTACTATTTTTGATAGTTGTAAATAGGTACT
ACATATTGTGCGTTTCACCCAAATTTGGACTTGTGCGGTATAACATTCGAATTCATTTTAATCTTGTACAACATATATTGTCGATTTGATACAAATTTGG
GGAGGGGGTGCAATCGAATCGCGCCGACCAAACCGATCCACAATCGATCTGATTGGTTAAATTTCATTGAGAAGGTTTTGATTGGCTAATAATTTTGAGC
TCATCTGAGGTAGCCAATCAAATCGATTTAAATTCCAACGAGAAACCACGCCACAACACGATATTTCACTCGAAAGCACAATACAAAGATTATATATATA
TATATGTGGTTTTGCCCCATGCCGAGGGACTGGGCCGAATCAAGCGTTTGGATTGGCAGAAATTCGACATGATGTGATTTGATTGGCTTTAAATGGTTAT
TTTTATTCTCTAAAGATAACATTGAGGGGTCGAATCGAATTGACCATGTATATGTACATACCTCATCAATCATACCATTTCGTATAGGGCTGAGTATCGG
CAAGGAGGGGCCGTTCATCATGATGTCGTGCTGCTTTGCAGATATTCTCATGCAGGTAACGAACGTACCAATATCCCTCGGTCATCTTGACGTTTGTGTT
GGTAGATGGGGTACTTTCGTCGCGTGTACGAGGACTCGTCCAAACGGTACGACTCCCTGTCACACATTTATATATATATATATATATATTTGCCTAGTCT
GGAGATGCTCTCGTGCGCGTGTGCGGCGGGGGTAGCTGCCACATTTGGGACTCCGTTCGGGGGGGTGTTGTTCTCCGTGGAAGTGACTTCGTCGTTTTAC
ATGGTGCGCAACCTGCCGCGGTCATTTTTTGCGGCGCTGGCCGGCGCCGTGACCATCGCGTTCCTCGTCACTGACGGCCAGTACGGGCTCTTTGATCGGT
CGGCTGGGCTCGGCATCACCGACACCAACTTTACCAAGTGTGTATCAGCTATAAGTGAGAATGCGATTCATTTAATTTGATCATAATAGGGTGTTTACGT
ACGTGGACGCGGGCATTTTTGTGTTTATCGGGGTCGTGTCAGGGGTGCTGGGCGCCGTGTTTATTTCGATCATTTCCGTGCTCGTGCGTGTACGAGACTC
GTGGTTCTTGTCCTTGGGGTACCATCTATATATATATTTGTTGGGAATTATATATATATATATTTGTTGGGAATTATATATATATATTTGTTGGGAATTC
TACATATATATATGTATACGTAGCGGGCCTCCGCTGCTGTACAAGCGACTGATTGTCGTGCTGGTCGTGACCATCATTGCAAACGTGTCCAACTTTTACG
GCGATCCAGCGTGGTTTTTGCATCGTGGTAAGACGAACAACTATATATATTTATTTTTAAATATTAATATACGAATAGGCTCTCCGCAAAAGATCATTGA
CACATTGTTTACGCAATCACCGACGAGGGAAGACGGGGCGTTGCTGGCGCGGTCGCTGCTCACGTTTCTGCCTCTCAAGTACTTTTTGACCATCGGTACC
GTACTCGTCTATATATATATATATATATAGCTAACCCCCGAATTAGTGTGTGTGGTCGTACCCCTGCCCGCAGGCATCTTTACGCCGACGTTTGTGATTG
GTGGGATCTTTGGACGGCTCGTGGGCGAGGCTATCGTGGTCACGCAGTTCGTCCCGACCAAATTTGAACCATACGAGTTTGCCATCATCGGCGCGGCGGC
CTTCTCGGCGGGGGTCACGCGCGCCATCTCCACTGCCGTCATTATCATGGAGATCAGCCACAACGGGTATATATATATATATGTGTGTGTTTATATGGAG
CACTAACTTTATATGGGTTGTGTTTGAGTAGATACCTTACAATCCCAGTGTCCATCTCGATTTTAGCAGCGTACTTCACGGGAGGGCGATTTGTCGAGAA
TGTGTACGTCGCCTCTAGAAATAAATATTATTTTTATATATTTATATATATATAATCATGCTTGTAGGTACGACGTGTTGATTTCGACCGCTCGTTTGCC
GCGGTTGTTAAAGCTGCCCAAAGCTGCATATGATATTCCAACGTGGGAAGTTATGAAGGTATGGGTCGTTTTGGGTTCGAATATAAATATATATGAACAT
TGGGATAATATATTTTTTATGTACTTAGACGGTGGACAAAATCGACTTTTTAAGCGCCGACGTGTCGTACCGAAAGGCACAAGACATGCTCACGTCGTCG
CAGGAGCCGGTGTTTCCCATCGTGGTGAGTTAGATAGATATATATATAGACGCAAATATATAAATATATATTCGTGATATCCTAATTTGATGGTGTGTAG
GACAACACGGAGTTCATGCACTTGATTGGTGCCGTGACCCGCAGTCGCCTGAAGGAAGCGATAGATTACTGCAAGCTCAAATCGGAAGCCCTTGCCCAAG
TACGTTATTTACTGAAATATATTTGGATAAATATATATTTATTTATTTAATAGGACGGAAAGCAGGCGCAAAAGAGCCTCATGGACTGGCGCATTCAATT
TGCATATCGTCGCGGGGGGCATATCTTGTCCTTGGACGACAATGCCGAATGCACGAGGACCAAACTCACGGTACCCTTTAGCTCCTCGATATATATAATA
TTAATATATATATATTCATCGCATTTGTAGGTGCTGATGAACCCGAGTCCGTTTCAAGTGGTGGAAATGACGACCATGCAACGCGTGGACGCTGTATTTC
GCATGCTGAAGCTCAACAATGCGTAAGAGACATGACTATCAAATATTTATATATATATATATATATATGATCTTAATCCCTTATTGTACTGTAGGTACGT
GACGCAAGCGGGTCGACTGGTGGGAGTGGTATCACGGGCGAGGCTGATGCGGTTTCTGGGCACTGTAAATGAATCATCTATCCCTTGATAAATGTGGACT
TACGAAATCTACTGATAGGCCACCAAGTACCGCATCCCAGGGGTCCTGCGCCACTTGTCACACATCTTTTGCAACGTCTATCCTGATGAAAAGCACGACG
ACGCCAACTTAAAGAACGAGCCCAACGCAGACGACTACGTTCCCATCCCGTAGTTTTCAAGATATAAATGACGGAAAGGGATAAATAAATAAGTGATGAC
AAGGCTTAGTCCATTTGGCGCCAACAAGTAAGTGCATATCGCGCGATGAAAACCTTCGAAAATTATTTACCTTTATAAATTGATACAATATTGGCTTATG
CAATATATAAGATAACGTTACAGCAAAACAAAATTATTTGTGAGAGTGTCTAACTATTAATATGGTGCATGCATTGGGAGGAGACGTTTTAGTTTAAACG
CCTCGTTTTTTTCAGTTAAACCCACGTAATGTTGACGTTAAATCATTATTCCTTACGTTTTTTATGTGGTAATTAGGTTAAACGTCCGAAATAATCCGGA
TATAATGGAAACGTTCATACGGA