Transcript Name :
Aphas_H257_00004
Orientation:
(-)
Number of Exons:
8
Description :
predicted protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain40.4PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain4SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-828
*** None ***
*** None ***
TypeScore
nuclear783
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
KO ID
K08866
K08866
*** None ***
Sequence
        2924 bases(100 bases per row)
GACGGACACAGCTCGCTCGGTCGACGATGGAGGAGCTCCTGAGGAAGGACGAGAACTTGTCCGATTTCTTCATGCTTGGCATCAGAGACAGCGACATGGA
TGGAGATCATGCGACCGGAGCAGCTTTGCTTGACGAGAGAAAGTCCATCGTGAATGAGCTGTTGAAGAACCCTTTCGATCCAGCGTTGTGGAAGCGACTC
GTTGGCAACTGCAAGCGGCTCGCGGGCAGGTATCCGCATCTAGTCCAAACTATATTCCGTCGTGCGCTATCCTGCTTGAAGCAACCTGGCTTGGATGGGC
ATCAGCGATCCGACCACATCGACATCATCCTCGACTACGGCGACCTGCTCAAGGATCCAAAACGCAAGCGAGGGTTGCTGCGCCAGGCATTGATGGAAGG
CCTTCCGCAAAACCAAACCAAGTTCTTCGAGTACTACGCCAAGTTTGAGAAGTCTCAACGTACGCAGGAGCCGTTTAAGACAGACAGTACATGTCGCCTC
ACTCGTTCTTGTAGACGAAACCGACACGGCACACGACATGTTAAACTTGGCGGTGGCGAAAAGTCTGTTGAGCAGCGCCGATCGCGACAGGATCTGGAAA
GGGCTCAACGACGCCCCGCCTGCTCCAATGGCCGTCGTAACGTCCCCCACCCCTCAACCAACGCTGCGGCGCGACTTCGTATCAGGCATCCAAACTCCTC
GTCAACCCCAGGACGTTGGGGTGCCGCGATCGATATCGAAGCTCAGAGAAGGACTCATGACTCCGCTGTCGTCGCGGCAACACCCCTCCTCCACCCGGTC
CAGTCAAAAGTTTCCCCGCATTACATTCGACCGAGGTATTCTGCTCGCCCAAAATGTATAGCTGGATTCGTCATGTCGTCGTACATAGCCAACTTGGGGT
TGCCGCAGCGAGTGCTCAAGTCAGAGCACATGTCCCAGGACTCGGACAAGGAGAACGACGAGCCTGAAAGCACTCGACCACCTACAGTAGTATGTTCGAG
CGTCGTTGTGAATATTCGTTTGATTTGTAGCCACTCCATCTTAGGAATCTTCCAAGAACGTTCTTCCTGAACGACCGACCAGTGGCGCGACGCTGTGGCA
GCCATCCAAGATTCCGCAGCGGGCTTCCACTGATTTCAAGACCTTTGCGGCGCCAGGTCAGCCCATTGCGTGGAAATCCACCCCCGTTTCTGCATCCGCC
AGTGATTTTGACATTGAACATGCACGCTTTGGTGATGCAGACGCACTCAAGCAGCGCTACGGCGGTCCCACTGCCATCGCTCGGTCCAGTGACCTGCCGC
CCTCCATTTCGACGCCATCACGGGGAACCGCGCCATTGGCCACGCCTAAATCTGCCATGGCCACTGGAAATCATACTGCAGTCAAACACGTCGTCAAGCG
GCCGTTATCTCCTTCCAAGCCGTACCAAGTGTCGGAGGATTTGATGGATTCCCCAACCAAGAGCGACATGGAGATTACCTTGGCCCATGAGTACGAAGCA
TTGGAAAACCCGTCAAAGCGCCGTCGAAATGAACCGAATGAACGCATCGCCAGCAGCCCCGTGACTAGCAAAGCCAACACGCCGTCGCCGCCTCCTCTCT
TTAGTGCCAGTCCCAGCGACAGCCGGCCTTTGCACGTGACGGTGGTCGACCGGTTGATTGACCCGAAGAACCATTTCACGGTACTTCCTACCTAGTAGTC
TATTCATGCAGATGATTGTATGCGTCGGTAGGTCAACGGTATTACATTTTTGAGCCTCAAGCAGATCGGATCGGGTGGCACGAGCAAGGTGTTTCGAGTG
CTGGGGCCGGACATGCAAACGTACGCTCTCAAGCGCATCAAGATGAAGAAGATGGACGAGGCCAGCGTGACGAGCTACCAGAACGAGATCAGCTTATTGA
AGAGTCTCCAGGGCAGTCCGCATGTGATAAAACTGGTGGCCAACGAGCTCGATTATAACCTCAAAGTGCTCTATGTGGTACGACAAGAGAGAGACAGATG
TGGTGTGTGTCGACGATGTGTTGCATATGTGTGTGTAGGTGATGGAGATTGGCGAAATCGACCTCATGAACAAACTCAAGGAGCTCAAGCAACACAACAT
CGTCGTGGAAGAAAACTTCCTCCGGATAGTGTGGCATCAAATGCTGCAGGCAGTCAACTACATTCACAACAGGCGCATTATTCATGGTATATAACAACCA
GTCGACGCGAAGTTACGAATATCACACTTTGTAGGGGATTTAAAGCCGGCCAACTTTTTGTTCGTCAATGGCGCCATCAAGCTGATCGACTTTGGAATTG
CCAAGGCCATCTCGAACGACACGACCAACGTCATCTTGGAGCAGGTCGAAGGCACCGCCAACTACATGCCACCCGAAGTGGCCGCGAGCTCGCTTGGCCG
CAGCGAAACCCCGCAAAAGGTGCTTAGTTTATTTCTTTTATATTTTCTTCTTGACACGAGTGTTGATTTGATGCAGGTGGGGCGAGCGGGCGACATTTGG
TCCCTTGGGTGCATCTTGTACCAGATCGTATACGGGGACACTCCGTTCGGAAACGTGACGCACATGATTCAAAAGTTTATCATGATCGCAGACCCCAACC
ACTCGATCAGCTTTCCTCCCCTCAAGAACAAGCAGCTGGCCCACGTCGTGCAGTCGTGCCTCCAGTGGGACCCCAAGCTGCGACCAGCCATCGAGGGCCC
CCATGGACTACTGGAGCACCCATTCCTGTACCCCGACCGCGTGGTCGCCCCCACAGAGCACTCTGTGTGCGAGTCCCTGCGCAAGGCAACGTCTTTCGTG
CAAGCCGCCACCAGGTTTAGTCGGAATATTGAGCACGACACGGCGATGCTCGTGGCCGCGGTTAAAGCGGCGAAGCGAGCAAGGGCCGAGTAATCTAATT
TATATGTCGTTCAGTGGATCTCGC