Transcript Name :
Aphas_H257_00005
Orientation:
(-)
Number of Exons:
8
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
BAR domain0.0095SM00721
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-376
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
cytoplasmGO:0005737IEA
*** None ***
*** None ***
Sequence
        1744 bases(100 bases per row)
TTTGAAACGAAGATACAGGATGGCGAGCTGGATGCGATCGGGGGTACGTCAACATGGCAAGCCTTCCTGTATGGATATGAGCATGCATGTGTGTGCATGG
TATATGTGTTGTGTCGAATCATCATGAAACCCCAGCTCTGGCTAATTTGTCGTAGTTGCAATCGATGGTGGATACTTCACGAAGGTATCGTTGCCGTCGC
CCGTCCGCCATGCTTTTCCTCACCAGACGATTAGGTTGAAGGAAGAGATCTTGCAGACGACGGGTGTGCACGACTCGGGATGCGTTGACCCTGTGCTTGA
CACGCGGACCCAGCGGTACATGCACCCTCCCATCCGTTCATCCTCATTCTATTCGTCCACAGCTTCAATCAACAATGTACAGCCATTGAACGACTGCATG
CATCAACAGCAGAGTACGTGAAGCAAGCTGATGCCATGGCGAAGGCATCATCAGCCCTTGTTCACGAGTTTAAGGCGTTTTTCAACATCCAGTTGGCCCA
GGGTACGGCAAACCTCGACAACGATGATCATATCCCTTCACCATGTTTCTTCCGTCGATCAGGCAAGGTCGACAAGGAGTCCGAAGACTTAGTGCGGTAT
GTACTTATCAACCACGCCGCATCCAATGCACATAACGTAGACAGCTGGCCCAAGCCTCCGAGTGCCTTGAGAGCATCCACTGGGGCCTCCAGAAGTCCGT
CCATGCCGCAAGCAGCACCATGTTGACCGAAAAGGTGCTCAAACCGATCTCCAAGTTGAAGCAACACAACACGACCATCCAAAAGCACGTCCAACTTCGC
AAGCAAAAGGTACCCACCTTCCTACTCAGCGTCAATGTACTTCGAACTAGTACGTACGTACGGCGGATAGATGCTCGACTTTGACGCGCTTCGTCGCGCC
GCGGGCACATCTCCAGAATCCCAAGCCAAATTGCGCATCGCCGAAGAAAGCGTGGTGAAAGCCACGGTGGACCTCAACGACACGTTCGACCGCATGGACG
ACAACCGGGGCTTCATCCTGCGCAACGAGTTCCTGGCGCTGACCGCGTCGCAGGTGCTGTGCGTTCATCGTATTCCCTGTATGTCTTGAATGACAAATCG
TGTACGGTGGCTAGATCTTCGTGTCCACCAAGTGCCATGTGGGCCTGCAGCAACTGCTACCGCTCATGCCTGGGGTCGCGGGTCGGTTGTTCGACTTGAG
CTTGTTGTCGCAAGCGCCACAACTCGCGAGTGACCCCGTGCAACATGCCGCGCTGGGGGTGCTGGACTACGCAGGCGCCAACTGCTTGCTGGAGCGACCT
GTGAACAGCATGACCCGTCTCGACCTTCCCCTTCCAACCACCGATCGATTGGACCCCGCGTCTCCCTTTGACGTACGTATATGGATGATGCCGACGGTTT
TTCATATGAAGTTAGACCATGCACGCCGTGCAAGGCCTCGCGGACTCGACGTATGCTCGTCCGCCCGCCTCCCGCGAATCAAGTGCCTTCCAGCGAACCC
CGAGTTTGTCATAGGGATCTACCATAAGCCACCACAAATCACACTTGGACGGCTTGCTAGTGTTGTGCGTTGTGCATCATCGTAATGCATGTACACATAG
CTCAGCGCGTGGGGGTGCTACGGCGACTTCGTCATAGCATTCAGCATGGCGGTATGGCACTCGGAGCATGTCGCGGTTCCTGCTTGACGAAGACCACAAG
TTCTCACCAATGTCCATTGGAATTTATTTGATATTAACATCAAG