Transcript Name :
Aphas_H257_00041
Orientation:
(-)
Number of Exons:
20
Description :
PREDICTED: ankyrin-1-like
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ankyrin repeat3.7PR01415
Ankyrin repeat3.7PR01415
Profile scan predictionP-Valprediction_id
Ankyrin repeat-containing domain49.074PS50297
Ankyrin repeat10.606PS50088
Ankyrin repeat15.013PS50088
Ankyrin repeat13.491PS50088
Ankyrin repeat13.224PS50088
Fido domain16.228PS51459
HmmSmart predictionP-Valprediction_id
Ankyrin repeat0.0066SM00248
Ankyrin repeat1.6SM00248
Ankyrin repeat7.3SM00248
Ankyrin repeat770SM00248
Ankyrin repeat0.0033SM00248
Ankyrin repeat700SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Fido domainIPR003812
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-983
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        6995 bases(100 bases per row)
CCATGGACGAGCTCCCGTCAAAGCTTCGTGATACGACGGCGCTGTGCTGGGCTGCGGGGACAGGCAATGTAGACATGCTTCGTCGACTTCTGACAGAAGG
AGTGGATGTGAACCTCGCAGACTACGATCGACGGTAGGAACGATAGGATGATCGTTCACGGCCGTAGAGTGTGTTAACATTACGTACGTAAACAGGACGC
CATTGCACATCGCTGCGAGCGATGGGAATGCCGAAATAGTCAAGCTCTTGATTCAAGCGGGCGCCAACTGTCATGCCAAAGATCGATGGGGTGTAACACC
TCTCGACTGCGCAAAGGACGCCGTGGTGGCGTCGTTGATGTCGACCCATATTCGTGCAAGTCTTTTCGCCGACACATCAACGGCGCCATATCGACGAGTT
GGAAGCCACAACGATGCACTTGATGCACTTGATGCAAACCGACCCAAGAACGTGTTGGGGGAAGTCCACCAAGTGTTTGCCGCAGTATGTCGTCCTAACC
TGTTGTCACTCCTTCATTCACTCACCTCTTGATATGTATAGATTGCGACAGGGGACACGGACACATTGAAGCGTGCGTGGCTGGATGGTCTTGCGTTGAA
TGCGGTTGACGGCGCGGGTCGTACGGCGCTGCATGTCGCTGTCGAGAAGGAGCAAATGAACGCGATTGAACTGTTGCTGTCTGCCGGGGCGACCGTGGAC
GTCGCCGACGAGCAAGGCCGCACGCCCATGTCGATCGCTGTGGAAATGAACGCGTCCAACGTGCTGAGTCTCTTCCGTCGACATGTATACACTGCGTCGT
CGTTGCCACAAGTGCCCATCACGTTGGACGTGCCCCACGCGTTCGCCGCCATCCAGCACGATGACCTCGCGCGACTGCAGCAGCTGGTACCACGACTCGT
CCACCCCGACGTCCAAGATTACGACGCCAGGTATGTCTTTATAAATCCCTATATATCGCGATATATGTATATATATTTCTTGCTTTCAACCATTCTCTCC
ATTGATTTCACAATGAAACCATTTTGTATTCTTGTTCAAGTCTTATTGTGATTTATAAACTTCCAAACTTTGTGTAGTTTGTCTAATCAATATTGAATCA
CTCTGGAGTTCTGATTGGCTGACTCTACTTGTCCTTTTGAGCCAATCAAATCCACTCAAAATTGGATTGGCCAATAGCATCGATTCGTGATTCGATTCGA
CGGGGTCTGGAAATTCATACCGAATATACCACAATATATGTTTTACTCATCATTTCGCCTGGCGGCTGGTTGAATCAACTGCCAACGATCGTCAGACCTG
CGAAAGATGATATATATTTAAATTTAAGGGGTGTTTATTTTGTGAAGATTCATGCGTTTTTGTCAATCATACACTGTATAGTATATTTCAACGTTTATTC
GATTTTTATCCAATCAAACGGCTTTGCTTGACTTAAACGTGATTTTAACAATCCCCCCAAAGTAGTGGGCAAATGTGGGCGAAACGCACAATCTCAATAT
ACAATGGTTTCCAATCTCAATATATCATGGTTTCCTATATCAATATATCATGGTTTCCAATATTAATAATATATTATGGTCTCCTATATCAATATATCAT
GGTTTCCAATATTAATAATATATCATGGTCTCCTATATCAATATATCATGGTTTCTAATATTAATAATATATCATGATTTCCAATCTCAATATATCATTG
TTTCCTATATCAATATATCATGGTTTCCTTTTTTACAATACCGCTACAATCAACACACACCTTATAATATTCGAATCTGTCCCAAGTAAAAGAAGTTATC
TATCTATTTCGTACAACCTGTATATATATATACCTTGTATTTGCAAGCATTCAATTTCGTTTGATGATGGCGCCGTGTAGGTCCCTCTTGCATGTGGCGG
CTAGCGAAGGCCGGACGTCCATCGTTCAGTTTCTCGTCCAAGTGGGGGCCAATGTCAACTTGCTCGATCGCTGGGGAAACTCGCCCCTCTCGGAAGCTAT
GCATTTTGCACACACAGACGTGGCCACGTACGTACATATGTCCATATGATCTAATTTATGGTTCAGGCTTGTGTACAACCCATAGCAATTGTATTCCATC
GCATTTATATTAAAAAAAAAGATACACCAATTTAAATGAATACCCTAGTCCTTTAGATTTATAAAAATTAGACCTCTTGATGTGGACTTGTTCCCTATTT
CGACCGAAATTCCATGGTGTTGCTAGTTTTAAATTTCCTAACAAGAGTCACGAATCTACTTTTTTGTAGGTACCTGCGCGACCACCACGCGACGGAACAC
GGGCTAGACGACAACAGCTTGGCGAAATCCCCGCATCAACTGGACTCGACTCTGCTCAACACGGCGCTCGAGCACATTTTACGATGTGTGTGTCGGGTAC
AGCAGCTTGCCTTGCATGTGTGATCGTTGATTAATATTATTATGATTATTCCACGTGAAAGCAACATAAATGGCAAGTGGGCGAAGTGTTTGTCCCGATA
AAAGACGAAAACACCAACGGATGTGCATTGGTGCTGCACAATGTATGGTTTCGTCACACATACAACGACACGTTGTACGTATACCTCTCCTCTTGTCAAA
TATATGTATATATATATATTATATTCACGGATCATGCATCCAATACTACTAGATCTACTACTATAGATCTAACATATTAATGTTGTTTTTTGCCTATGGA
CTATACAATTCATATGTTAAAGTAGACCGTTGCAACCGTTGGCTCAGTTTCGCAAAGCGAGGGGGATGATGCTGCTCGATCCAGGACACGACCTGGCAGG
GCGTGTGTACAGGTGAACAAAAATATATAAAAATTGTGTTCTATCTAGAGAGTTTGATCTTGATGTATATATTATATATATATATATATATATATCACGT
TGTTTGTGTATTATTGGTGTACGCAGTGGCCAGCAGCCGGAATGGGTCGCTAGTTTGCATACAACGAGTCAAAGCAAGTTCTTCTTCGTGCCACATGCTC
GGAAAGCCGGCTTGAAAGCGGTCGTGGCGGTGCCCATGGTGCACACGCTGTCGGTTGTAGCCGTGTTGGTATGGTACGCCACCGAGGTAAAGCAAAATAT
TATTATACCCCACCCATGTATATATATATATCGAATTTCAACGTAGGCCCTACCTGAAGACCCTGACGAAGTGCATCGTATTCAGCGACTGGTCAAGGCC
GTTGTGTTGTTGTGTGTGTTGCGTCATGTACGTCGATCGAGGCAAATTGTTGTCCACAACGGAGCAGACATAATCGTCCATAGTATTATTTTTTATACTA
TGATAATATTTTGATTTCAATATATGAATTCGATTTATAGGAGTCCACAGCGACGATGTCGCGGTTCCAGTACTGCCAAGCGCTGGAGCATGCGTGCACA
GGCCAAGGCGAGCTCACAGCGGTCGACACTGTGGCCCCAGACGACGGTATACATTGATCAACATGTTGGGGAGTAATTGCAGGGTATATTGATTGAGCCG
CCCAAATGTGGACTTTTGTGCTAATTCGATTGAATGTTGTGTGGTCCTGAATTTTTGATTGTATGATATATATTTCGTCCAGTTGGGATGATCTACGTTG
TGTGATAGACTCATTTGAATGGATTTTTTGGATTGGCTACTTGATTCGTGTTTGGGGGATTATGATTGGTCAATGGTCGAGCTCTGTGAGCGATTTCGAA
TCGACTCGACATTACTATGTACTGCCCAACAAAACCAGTTAGCGTGATGAAATGTCATAACTAACTAGTTACATATTCAGAGTGGTAATATATATTCCTG
TTGGGATATCTGTAGCGGCGGTGCACGACGTGGTGTCGTTGTGTATATCGTGGCACTTGTTTGATTATGCCATGAAGCTGGCCACGTCCATGAGCAGCGA
AGACCACTTGGTACGTTCTATCATAATACTTCGAATTGCCCACACAATATATATATATATATCATACTAGTGTTACTACTGTACGGCAAACAATCAAATA
TTTTTGGATATTGGTCATATACAAAACAAAATCCTACGATGAATACTCGTGGTTATATATTTGGAAATACCATGGCTAATACATTCATACTATTGCTCCC
AACACACTTTCTTGGATATTGATGTTCATACATTTATTATATATAGTACGACTGCTAACCAATTAATCAAATATCCTTGGTTATAGAATACAATTGCTGA
TAAAATCACCATCCTACTATTGGATATAGCATGCGATTGCTCATACAACAAATTCAATACTACTAATCCGAACCACAATCACGTGTTCTTGGATATATAT
ACAATACTATTAATACTAACAATCAAATATATTTGGATATATCATAGGCCACGATCGATTTGTTTGGGGCGTTGGTGGCGCTGTTGAAGCGAGGATTTTT
CGATGACGTTGTGGGTCCCACCTTGCTAGACCTGGAGCCATGCGACGTGGTAGACTCGATCTCGACCAAGGTAACAAATCGCATTTGCAACCTCCGTGTC
GACTCAAATGTACGTACATATGTAGCTGCACTTGGTGCACGTCGTCGTGTATGTGTTGGCGTATCTGACGACCGTAAGCCCCACGGAAGGCTCGGTCTAC
TCGAAAAGCCACTTGTTTCAAGACGAGTTGCGCCAGTATGTGGCGAATCTCCAGCCCATCGGTTTAGATGGTAGCAATAGCAGCAGCAGCGATGACATGG
AGGTAGTGACCCATCTACGAACTACGATGAACGAACCAACTGACACTGCCTTTACTAGGAGGGGATCCCAACAACAACAACACAAACGACAGAGTCGGCC
GAGGTGGTAGAACCGCTAGGCATCCACCCGACCCCCGTGGTGGTGGAATGTGTGCTTTGCAAGTTCAAAGTTCCAGGTGTAGATCTCAATATCCATAGCC
AGGGGCGCAGGCAGTGTACTGATGAACATATGTGACGATGTGTTTATAGGGCATATACATCCAGGGTTACCTCGCCCGTCTGTAGCCCCGTCGCCTCCAC
CACGTACGTACAGTACACAACATATACCCTTCCCCCTTGTGTTTACATTTGGAGTTTGTTTGAACGAGGTAGGAACTCCCCAGTCGTCGATATTTACCCG
CCTTCGATCTCCAGTGTGGCGCGAGTTCCAAGAGGTTTGTATTTGGCTCTCGATCCTGGTTTAACATGGATGGACCGTGTTACTTTGTCCTTTTAGCCAA
AAAATGTGACCTGACTCTCTAGATCAACTTCTTTGTCCTGCATTTTGTATGTAAACAGGTGTCCTGCAGTGATTGGTGGTATCACACTAATTGAAGTCAC
ACACACTAATTTGACGTTGATGATGGTATCCTGTACCTGGATTCGCATCGATTCTTGTGAATACAATAAGTATTGTCTTTCATTACTCAAAATTTGGTTG
ACTTTTGTGCTGATTGTGTCGATATATCGATTCTTTGTACTGACTTTTGTATGTACAGATCGTCGAGTATCACACTAATTGAATTCACATACTAATTCGA
TGTTGCCTTGGTCATCGAAGAGTGGATAAGTTGATTGGCTACTTGATTCGTGCTCTGGGTTTTGATTGGTCGATATATCGATAGTCTGCCGATGTATTTG
GTTTTTTCTGCTCAAACTCGATTACGAGCACCGCAACTCACTCGAATTTCGAATATCTGGACAATATTATATGGGGATGTAGTTGCCCTGCACGTTAGCC
AATGAGTGGGACCGGTTCCGCGGCAAGGATAAGCTGGCAAGTACGCCCTCCCAAGACTCGTTTCGAAGTGCCAAGTGGACAACGAGCGACGTTTACGACA
CTGTCGGCAACGCCCACGACAACCAGACGTTATTCCGGTACGAATCTATCAATCGATCTTGTCTTTCATATATCTATCGATATATCGATCCATTCTTTGT
ACTGACTTTTGTATGTAAAATTATGCAGTGTCGTCACACTAAATAAAGCCACACACGAATTCGATGTATTGTATTGTTGAAGACTGGATAATTTGATTGG
CTACTTGATTCGCGTTCTGCGTTTTGATTGGTCGTTTATATCGATTGTCTGCCGATGTATTTGGTCATTCTGGTCATATTCGATTATGAGCATCGCACTC
CAATTTCGAATCGAATACGTTGACAATACCTCAAAACAACAAAGCAACTCTCATCTACACAACCAACACTCTGTTTCGGGATAAATAGGAGGTCACCGGT
GGGGGTGGGCGATCGAAGTAGGGTACTAGCGGTGCTCAATGCCATCCTGGACGACACGTCGGCGATGCTCACGTTTGATCAAATCACGGCGCTGCATGAA
GCGATCTTTGAGCAAGGGCATGACGGAGGTACGTACAGTAGTACGAGAAGCATGCTCGGTGTTGGATTTGTATATTTTAATATATATATATTAATATATA
TATATCACATGCAGGGGCGATTCGAGAAGATGCGGCGGTGGGGTATGCCTCGGAGCGCATCTACAGAGTATTTCTCCCGTCGGTGGAGATTGAACTGGCT
CTTCGACAATATGTGACAACGTTGAACGACCCCACGGCGCTGCCCCATCCTCTTGTTCGCGCATACTATGCGTTCGCCGCACTCGTGTTTTACATCCATC
CGTTCTACGATGGCAATGGACGGTGATAACTCATTCCACGTACCCAAAAACACATACACAATTCTGTGACATCGTTTGGTATACTGCCGTGGTAGGGTCG
CCCGGCTGCTAGGCAACGTCGTCGCACGAAAGGGAGGGTTTCCCCATGTAATCCGCCACCAAGACAAGACCATCCAACTCACGGGCTTCCTCGAAACGAC
TTTGAACATGCTTGACCTCCATGAAGACGCGTTGCGATCCCGTCGCACCCGCCTCGCCAGCAAAAACACGTCGACATGGTTTTAGAGCTATCAAATAGTT
ACTATTTAAAATGCAATTCCTATGTCTCCATACTCGCTGTCACACGAGAGTGTGGAGTAAGTGTGCGATACTAAATAGGTATATATATTGTCCAA