Transcript Name :
Aphas_H257_00044
Orientation:
(+)
Number of Exons:
11
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-74
125-250
316-317
98-101
274-292
341-481
75-97
102-124
251-273
293-315
318-340
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2357 bases(100 bases per row)
ATGGAGGTGCCATTGGAGGCCATCGTCCTGTGCGACGCCGACGCGCCCCCCATCCTCGTACCTTGTAGGAGACATGCCATAGTCGATCGAGCCAAAATCT
ACCTCACTCAAGTATATATACCATCTACCATCCATCGTTGACCCCCAAACATGGCAGTCTCAACGATCTGTTTTAGATTGAGGATCGAGCAGCAAAGAAT
GATTCCATGTGGGTCAACACCGTCCACGACTTGGGCCAACTGCACACCCTCAAGCTCGTACGTCAAAGATACTGTAACATGACTCTAAAATGCAATGATG
GGTAGCTCTATCGAAGGCAGCGCAGGTTGGAAAACTACATGTTTGGTCTCGCGTGCTGCAGCCTACTTGCCGAAGCTGCAGCCATCCACGTACACAAACG
TCGACCAACAGGACTCAATGTCTCATCCTACCCCATTGTAGCTGTACTGGAACTTGCCAAGTGCCATGCTCGCGATTGAAGTCAGCAAGGCGATTGTCAC
AGTGACCACCGTTGCCATCCTATACCTCCTCTTCTTTCGATACGGTAACCCTTCCTTCTCTTGTATCTTGTATTATATATATATATATTCCCATCACTCG
AACTGATATTTCTATCGCCGCTCCACGGCAGAATTGGCGGCTTGCATCCAAGTGGCTTCGTACGGCCTCCCCCCTGGGTCCAGATTTTATCACACGACGC
TACTACGGTGCTTTCTCGTTCCTCAATACTGTATAATCATAATCCTAACAATAATGATATTGACAGAGACTTTTGCCTTGAATGTTGCCTCCTACTGCTT
CATATCCCCCCGGGCCTGAGCACGTATACCTTGCACTCGGTTCTATATGTTTACGTGGACCCTCTAGTACGTACATGTACAATTCCATGATGACCAACGC
TCTCGTAACCATTCACTTTGACCAGTCAATTAAACCCGGGGCGTCAGTCCCCGTTTGTCCAACCAATGTACTGTACGCCACGTATAATTGCTACACCCGC
GCCACGTACAGCGCCTACCAATTCGGTATATCGCTCTGCATACATTCGGGCTATTATTTTTCCATGTCTAATATATATATATATATATATATTTCTTTTC
CAAGGCATCATCGTCGCGCCACGCATCTACCTCATTGGCCGGTACATTCGCAACGTGTTTGGGTTCAACACGAATGAAGCCAAACTCATCGGTAACATCG
ACACGTCAAGACCATATATATATATGTATATCTCTTCAGACTTTGACCATAAGACCAGGATCGCTGCAAAACGTGGACGCGACGTCAGCGTGGTTTGTGC
GCAAGTTTCTGTTTCGGTTTTATCCGGCGACGTTTTGCGTGTTCATTTTCGTGTCCGTGGGGGCCGCCACGGCATGGGCAGTCGATCAGACTGAGCACTC
CATGGCCAACGCCGACCTCGCCGAGTATGTCGACGCGCTCTGGCTGGTCGTCGTCACCATCGTACATACTGCGATACAAGGACACTTAGGATGTTCTTCA
AACGAGGTGTTGGGTCTAGGTGACGGTGGGTTACGGGGACTGCGTCGTCGTGGGGTTCCCCGGGCGATTGTGTGTCGTGCTCGGGGGGGTCGTGGGGGGC
GCCGCCATCTGCTCCATGTGCAGAGTGGTGGTCGTGGGGGCGTTGACCATCACTCCCAACGAACGCGACGTGATCGACATTATCACAGAGCGCACGCAAA
CGACCGAAAGGCGATCGGTGGCCGTTCGGTTGATTCAGGTACATTATACTCATATATATCGTAGATTCGGTACGAATTTCCGGATTCCTCAACCTCCCGC
GATATTTGATTGGTTACTCTGATTTTTGTTATCTCTGATTGGCTAAAATCTCTCTCAATTTTTCGTATACTTTCTGCTGGCCAATCAAATGTCGCGCAGA
ATTGGGAAAATTCGCAATATCGTTCGTTTACAATAAGGTCAAGCGAAAAGTGGTCATATCTTCTGTAGGCAGAATGGAGACGATACAAAGCCATGACAGT
GGGGCCACCGACTGACGGGTTACCTAGCCGTCGGGACGGCGTGGCGTTCACTGTGCACAAGGCCAACGTGCTCAAATTCAAGTAAGTACACCCTTATATA
AATATATAGTTGTTGATATCCCATGGAAGAGTTATGGCGAGCGCGAGAACTATGCGGCGCCAGCACCAGCAGCGCCATCACAGCTTGGATGCGATTTTGC
ATCGGTGGAAGCTCAAAGCCGAGGCAGCCCGATGCGACGACGTCGCGTCCACCAATGCAACCACCTCATGCGACGACGTGGTGGCCAAGTTGCGGCGGCT
GGTGTTGGCCTGTTCCGTAAACGAACTTGCAACTCAATGACCCGATTGACATTCCAC