Transcript Name :
Sapdi_VS20SDRG_17448
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.7392.3830.005
*** None ***
TypeScore
nuclear783
GO
*** None ***
*** None ***
*** None ***
Sequence
        1004 bases(100 bases per row)
CGCTCACCAACGTCGCCAAGAAGGCGATCCCATCGGACGGCAAGATGACGTGGCAGAACCCCGACACGGGCGAAGGCTTCATCCCGAGCCACACGGTACC
CAACGACACTACTCTATGTATACTCAAGCTGCACTCATTGGTAGGGCCCCTGCGAGGTGTGGCTCGACAACAAGCGCGTGTTTCAGAACGACGACTGCGC
GACCAACTTTGGCGACAAGCCGGCCGCGCACCTCCCCGTCGACTACTCGAGCTGCGCGGGCGACGGCTGCATGCTGCGCTTTTACTGGATTGCGCTACAC
CAGCCTGAGTGGCAAGTCTACAGTGCGTCCCACGACCTTTATGGCTCCATGGCTCACGCTGCGATACTGTGCGTAGAAAACTGCGTTCCGCTGCAAGGCA
ACGGCCAGAACCCGGGGCCCGCGCCGCAGCCCAACAGCGGCGGCCAGTGCGCCAACGCCAAGAGCGACCTCGACTACTACGGCAACGACATCAAGAACCT
TGGGGTGTGGGGCAGTGCGCAAGACCAGCTCAGCCAGTGTTGCGCGGCGTGCAGCTCGACCAACGGCTGCGCCGGCTTCTCCATCAACAGCGGTGTGTGC
TGGCTCAAGCACACGCTCGGCAGCCCGACGCCCCGCGCTGGCGTCGTCTCGGCCTCTGCGCCCGGCGCCTCTGCGGGCTCGTCCAGCCAGTGCGGGAGCA
GCGTCAGCACCGACGTCGACTACTACGGCAACGACATCCGCAGCTTTGGCGTCAACGGCGACACGGCAGCGCAGGTCGCGCAGTGCTGCAACGGGTGCTC
GACCACGACCGGTTGCGTCGGCTTTTCGATCAACGCCAACACGTGCTGGCTCAAGAGCTCGGTGGCGAACCCGAGTCCTGCGAATGGTGTCGTTTCGGTT
CGCATGGCGCAGCACCGCCTTCGTCGCGCTCTCTAGAAAATGTCGCTTTCGTGTATTCTCTTGTTGCGTTGTATAAATGAAATGAAATTCCTGATTGACG
TTGG