Transcript Name :
Phyag_g9572
Orientation:
(+)
Number of Exons:
10
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-174
604-689
750-755
816-864
971-1100
198-583
713-726
779-792
888-947
175-197
584-603
690-712
727-749
756-778
793-815
865-887
948-970
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4244 bases(100 bases per row)
ATGGTGAGCAAACGCACCAaggagcgacgacgagcgtcTTTGTCGTTCCACCCTTCTGCAATCCCAGTTCGACAGCAAAGAAGCCATAGTGACACCGGAA
CCTCAACCAAAACCAGCGAGGTGAGCTCTGCTGAGATTGTTATCGACAgctcgcagcttctgcgGACAGCTAACGATGGCGATGTCGCCGCAATGGAAGA
AGGCAAAGGCAAATACGGCAAAAAACAGAGCTTTGCGATGATGTCGCCCCGATTGGATGCACAGCTCGGCGGCTACCCGCCAGATTGTGGCACCAAAGAG
CTGAAATATCTCTCGTACGCTAAAGTGCTCCGCGATCGAGGAATGACACATCCAATGCGTTACTCCAACACTCGCGTGGATGCACTGGGTTATGCTATGC
CAGAGAGATACCCGTTGTGCTCCACCGACTTTGGTGCACACTCTTTCTACCACCTACCGACAGACTCGGTCGTGCTGAGCCAGTATGGGCTTGGAATTGC
GCTTTACTTCAAATATCTCAAGGTCATCACGTGGctttttctcctgcttgtgGTGATCAGTGCTCCTGCTCTAGCAGTTTATATCGTAGGAGGCGGAACT
TCTATGGCAGAACTTACTGCTCTTGCACGTCAGGATCTGCCGTCCGTCTTGGGTATCACTAGCATTGGTCATCTTAGTGAGGCCAGCAGTGTGTGTGACC
AAGCACTCGAGAGCACGGAACTGTCGCTGACATGCCCAGCAGGTGAGATCGGGTTTGTGAAAGCGGTATATTCGACATACGACACTCAGggaagctgcac
gtgccCGGAGCGCAACAAAGTCGCAGAAGGTTCTGGTACCTGTCGCGGCGATGCGGACGGATCGGTTTGTCCAGcggatggagctggatgTTTCCTAGGT
GTCCATCCAGTCTCGCTTCGACCTTGCTGTTCATTTTCACGAAATGTTACAACAAAGACGCCGCTCTTCGACGATATGCGGATCCGAGAAACTGAAGGTT
GCGGCTCCAACATGGCCCAACAAATAGTCGAAGGACTCTGTTTGGGTAAGAAGAGCTGCGCCCTCAATATCAGCGAGGATATCACGTACGTTTGGGAACC
CGATGTCAATTACGGAACAACCTGCTCGAAAGCTCCTACGATCGTCACGATCGACAGCGTCGCTAACATCACTAAGGAGGTGTGCGAGGTACGACTAAAT
GATGACAGCGAATACTCAAAGTGTGGCGCCGGTAAATCTCGAGCCTTGATTGTATACGGACGGTGCTTCACCACACGCGTCGACTTGTCCGGTGCATGGA
GCCTCAAGATTATCGGCTGGGACTCCATGAGCGTAAGGCAAATTTTTGCTTTTGGCTTGATATAGTTTTCATTAACAGGTTGTGATGTAGCGGCGTGAGT
TTCTAGGACTTGCGGTAGGATGCGATATTGCATGTAGCCTTGTGTTCTTCGGCGTTGTAATTTGGCTGCGGCGAAAAGAGAAAGAAGCTGTTGACCGCAT
CACCCAGGACCAGGTCAAGGCTCTTGACTACACTGTGCAACTTGTCAATCTACCATACCATGACGACCTCAATTTGCTTCGTCAGGAGGTAAGTATAAGC
CTCGTCAAACCGTTCGTAAAAATTCTAACGCAGTTTTTTTGTCGTGGTTAGATCCGCCTGCACCTCGAAGCTGTGCTGAGCAACGCTTCACCATTCGCAG
TGGATCTCGATCGTATTCGCGTTGCTGACGTCCAATTCGGCAAAAGTGCATCGCGGCATTTACGTTTACTCAAACACCGCGGAGTtgtcgtccaccgtct
tgagGTCGCACAGCAACGGCatgagaagctgaagctctTGCAAGGACGACTTAATGAAAACGTGTACGCGAGACGTGAGCGACGTCACCTGCGAGCTATG
CACAATTGGGAGGTGAAGTTGCATCGTTTTAACGTAAAGTTGGAAAATTGGCACGCCCACCACAAGCGATACAACATCTCTCAAGCTGTGACTGCTTTCG
TGACGttcgaagaagaggaaggttTCCATCGCTGCTTGCAAGAGTACCCAGATCTCGGTTGGTTCCACCGCCTTTTCCAGCCCTACTATAAGCGGTTGCA
TGGCAAACGACTGCGATTTCGTCCTGCTCCCGACCCGACCGATATCATTTGGGAAAATCTACATCACTCGTTCCTCGACCGGGTGCTCCGACAACTGGTA
TGGTACAAAATGAgttttgttgctgtcttGATGCAAGAATACTCATGATTGTCCGTATTTGTTTGGTAGCTCGTGGCATTGATCACTCTAGGTGTGTTGT
TCGTGAGTTTCATATCCATCTTCGCAgcgaaggagcagaagaGTAAACTTGACAGACAATTCGAACGGCCAGCCAGCTGTCCGATGAATGTTCTCAAGAC
GGATGTCATTCAAGACGAGATAAACAAGGTTTCTGGTCTTGTACCATACAAGGCACTCGTCGAGTGCTACTGCAAAAACTACCTCGTTGATCAGTACGTT
TTCACCTCGCGAACTTCCATAAGCTGGCAAAAATCTAACTTCCTCTTTGTTACAACAGCTCATTCCGAAGTATGATGTATGAAAGCTTTCACAACCCGGA
AACGGGGCAGGATGACATGCTGTGTCGGTCGTGGGCAACCACGTTTCTGACGACCCAGATCCTGTCTATCGCTTCAGTTCTGCTAGTTGTGGCTGTCAAC
TTGATCCTGGCGCGAATTCTTAACGGACTTGTTGCCTTGGAGAAGCACCACACCGAGTCTAGCCTCGTTGTATCGCGCATTACAAAAGTTTTCCTCGCTC
AATTTTGCAACACAGCACTATTGATGCTTGTCATCAACGCGAATGCCGACTATTTCTCCTCTGGGGAGACAGGAGCCAGCACTGGAGGTTTTTCACTGGG
CGCGTTGCACGTTTTGACCGGAGAGTACTCGGActtttcagcagcttggtaTAACGACGTTGGTGTAGCGCTCATGCTCACCATGATCATCAACTCGCTC
AGTACCCACGCGTACCTACTAGCAAACTACACCATGCTCAAAGCTCGTCGCTTCATGGATCGAGGATTTTCTTTCGATCACTCGCTCACAAAACAAGACA
CGCAACGTGATCTCGAGGCGCTATACCGCGGACCAAAGTTTGATCTCGCTTCACGCTACGCACAGTCGCTCACCACAATCTTCATCACGTACATGGTGCG
TCTGCATTGGAATGTTTGACCCCTTACTAAAAAAGCTAACCTGTATGACTGTTGCAGTTCTCAGCAGGTATGCCGCTGCTCCATTTTATCGGACTTGGTG
CAATGATCATGACGTACTGGGCCGACAAATTCAGTAAGTGATCCTCCAATAGCATCTCTGCACAACCACTAACATGATCTTGATGGCTTCAACAGCATTT
CTTCGAATTGCTCGATCCCCACCGCTATATGACAGCAAGTTAGCCACGGCGGCAGATTCGCTGCTTCCTTATGCAGTACTGATTCATTGCCTCCTAGCTC
TGTGGATGTTCTCGAACGACCGCATCTTCGAGTCCGAAAGCGACGAAATCTTCGAGAGAGCGGTTGTAAACAGCACGAGCAGCCCTGGCGATGGCATTCC
TCTCTTCGATGCAGCACGTCGCGGTCAATTGATCTCTCGTGTCACGCGTCCTCAAGTAGTGGTTCttttcgccttcttcgtcgctggttGTGCCATCGTG
GTCATGCGCACATTACTTTTCGAGTATGTGCCAGCCTTCGTACGCAGCATTTTCCCGGCCTTCGCTCGTATGTTGGAGACGCCTCGTGTTGCCAAGGGAA
TCCCAAACTACTTTGATGGTGAGTCATCGTCATACTGATACATGATAAGTTTCTGTCTCTGATCTTGTTTCACTCCACGATTGCAGCCATTCCGACTTCG
TGTCTGCAGGAAAAGttggcagctgcaggtggcacGCAGCATTTTCTGCGATCGGACTTGCGTACCAAGTACGAATGCGCTTTAGCAAACCGcctcgctg
aagaagaaacttTATCAAAACTGGGTTTGAAGCGCTCCACGTCCGCCATTCAGCGCTTCAACCAAGCAAACTTAATCGTTGGCTGTCCTTCGTACGGTAC
GTTGATGATAGTATATTTTTTGATCTTCAAACTTGTGTCTAATGCTGCTCACGCACAGCCATCAGCGACAACAAGGAGTACGTCGCCAAACTCGCCATCG
ATTCACACCTCTCGGAAGAAATTCCACTCGATCGGATCTTCTAG