Transcript Name :
Sapdi_VS20SDRG_01752
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, C2H28.933PS50157
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-472
NN-scoreoddsWeighted Score
0.7032.4520.005
*** None ***
TypeScore
nuclear870
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        1637 bases(100 bases per row)
GCCGAGTATTTTTGCCGCGGATGGACTTTGTGGACGCAAACGCGGCCGACTTCTTCGCGTCGCTCAATTCGTTCGCCGAGCCCGAGCCGGCGCCGCCGGC
GAAGAAGCAGAAGATGGCGCCGTCGTATGCTGCCCAGCCCAAGGTAGTGGCGACCACGCGGCAGACGGACCCGAAGGAGCTGGCGCTGCCAATGGAAGAC
CGCATCACGAACCTCCTCGTGCCCGACATGAAGGTCAGCGACATCATCCAGCTCATCAAGAAGATGAAGCAAGCGGGCAAGAGCGACGCCGACGAATTCT
CGGAGCTCGATGCCGAGCTCAACGCGGCGCCGCGCTTCGTCTGCGACGCATGCGGAAATGCGGAGCAAAACAACTTTATCACAGACTATGCGCGCGGCGA
CACCATCTGCACGGGTCCCGATGGCCGGGGCTGCGGCAACGTCGTCCAGGACCACATTGTGCACGAAGGCAGTGCCTACCGTAAGTTTGAAGGCGAAGAA
GACAAGTCGCACCACGGCCCCGCTCCCAACAAGCTCTTCTCGACGGGCCACAACCTGCGCACGATGATCTCGCAAGTCTGTGCACCCTCTTGGCCGCGCA
CAAGCTCACGGTGTCTCTTGCGATTGTGTCTCTAGGACGGCGAGCAGTCGGCCAACTTGCGCCGCGCCGCCGAATTCGTCGAGATGAATCTCAGTCAAAT
GGGCAAGGACGAGCGGCGAACACGTATCGGGTACAAGGACCAGGTTTGACAGCGTCGCGCCTCGATCACCATCCAGTATTCTCTGTGTACTTAGATGAAG
CAAAAGGCGTGCCGGCTCATCGACCACACGGGCGCCAACCTCGACCTGCACGAAATTGTGTGCAATCGCGCCAAGAAGATGTTTGCCGAGTTTCGCGACC
TGCGCGAACACGTGCACCAGTTCGAGGCCGTCGTCGCCGGCTGCATCATTGACGCGTACCTCACCACGGGCAAGGAGATGTACACGGCGCAGGCTGCTGT
CAAAATTGGGGCCAAGAAGCAAGGCGGCATTGCGCAGCTGCAGCTGCCGGCGCATAAGGCCGTCGATGACAAGAAGCTGCATCCGTTCAGCTGCGCCAAG
TGCGGGCTCATCTTCAACGCGAAGCGTGGCATGCAGTTCCACTCGTGCGGCGACGACGACGCGGACAAGAAGACGAACGTGCCGACAACACTGGACCTGA
AGCCGCTCGACGTGCCGGATGAGCTGTTGCCGATCCGCGAGATCAAGGACAACAAGGAGTGGTTCCGCTGCCCGCTCTGCCAGCGCATGTACACCAAGCT
CGAGACGGCGAACGAACATATGCAGCGCCACAAGAAGCAGAGCGAGAAGCGCAAGGTGCACATCGAGACGAGCAACATGGACACGACGCGCCTCTCCAAG
ACGAGCACGCTCGCCAGCGCCAACCCGTCCGTGCAGGTCAACACGCACGAAAGCGTCCTCTTCCGCGGCAGCGGGCGCCGGCCGTGGCTCAAGCACATAC
AGGAGGAGTACGAGAAGCGAACCAAGGACGAGGAAGAGATGAAGGGCTAATGTGTCGATACCGCTAACAGACAGCTCTCTTCTAGCGATGGCGTGTATGC
GTCCATGTCGCGTTAATACACTACTAGTACTACTATT