Transcript Name :
Sapdi_VS20SDRG_01101
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-24
624-635
788-824
896-1162
48-600
659-767
848-872
1185-1292
25-47
601-623
636-658
768-787
825-847
873-895
1163-1184
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4900 bases(100 bases per row)
TCTGAAACGGTAAGGCGCAATGATCGTACCGGAGGCGCCACGGGCCACGATCATATCCGTCGCCGTCCAACGCGCGGGTCGGTGGCAGCAGTACCTAGCC
GCGCTGAGTGCCGTGTACCTCGTTGCTTCGATGGGCATCGGGTACTACTACTTGCATCTCGTCCGGCCGAGCCTGGCGAGCGATCTGTGGTGGCGCGGCT
TCACGACGGCGGGGGCGCAAACGTTCCTTGGCGACTTGTACCACCGGCGCCTGCAGCTCAGCACATCGGCGCCGCTGTCGCTGGCCTCTCCTGAGCTCGT
CTTGGAGAAGGCGTACTCGGGCGCGACCTTTATGGACATGAGTCTCTCGCTCTCGCGCCACGTGCTCTTGCGCAATCTCTCGCTCGAGAGCATTTTGCCA
CCGATGCGCCGATCGTCGTTTGACTGGAACATTCGCATGTTCACGCAGTACTGCTGGGTCGACTGGAACCAATCGTACGAGCTCTCGGTGACAGCGGCGC
GTCAGCGTCGGTGCTATCTGAAACAAGCTGCGAATGCCGCCGTCTACTGGGAACCGCTTCTACGTAACTCGGTCACCCAAGATATTGTCCTCAGCCCCTA
CTCGCTCGCGATGAATATCTCCCTCTTTGAGCACATTGACGCGACGTCGCTTGGCCACGACTGGCTCATGTCTCTCATGTTCCACGAGTGGCTGCCGGAA
GCAGACGAAGTGGAGCTTTGGAGGCGCCGCGGCATGAGCTACTGGCAGACGCAGCTGACCAACTACTACGAGCAAGGCCTGCAACAGACAATTGTTGTCG
AGAATGCGCTCGGTATTCACCAAAATGTGACGGTTCATCTCATGGCGCAGAGCTATCGCGGCCTCGCGCTTTGGACGCTCGCGAACGCGTACCCTGGTGT
ATGGAACGACCTTTTCGAGTGCCAAGCTCTGCGCTGCAGTCTCATTCGCGGCGCCAACAGCTACTCGGACAAAATCAAGCAGAATTGGGAGGTAATGCTG
CTCGCGATCCCTGTCAACGACACACTGCCAAGACTCATCGATGCCAACATCGGTCCCATGGCCAGCATTGACGTGCGCATCGTGCTCTTACCCCCGGCGC
TGCAAGCTTACTATATTCAATACCAGCGCTCGGTCGTCGCGCAGCTTTTGCTGTCGCCTGCCATTGCAGCCCGCTACATGCAAGTGCCGTCGTTGGTGGC
AGCGATATCCCCTCCGGCGTGGCGTGGAGCCAACATGAGTTACTTTGGGGGCAACCCCATGTGCCTCAACGCCAAGCCCCAGCCGTTCGTCCAAGATCAG
TTTGGTTTCTACGATGCGTGCGACGCCCAAGCGCCGGCGACTCTGATGGGCACGCGTCCCAGCCTCTTTTTTTCGCTCGTGACGCTCGCCGTCACTGACG
AAAGTGCTATCGTACGTCGCCTCGACGCCATCTGCAACTGTTGTGCTCAAGTCGGCGGATATCACACATGTCTGGCGACGCTCAAGCCACTTGCTGCGGT
GGTTGCCGCCTTGGATCTCTCATCCCTCGCGACCTTCGCTGGGAATCTGGCTCTGGCAATGACGCAGCTGAATCTTAGCATGATTCAGCTAGGGATGAAT
GGAACGTCGCCCGTCTTCTTGACGCAGCCCGCGATCGCGCAGGAAGACCCGTGGTCCTTCTGTGGCTGGGCAATGGTTTACGACTGGCTGCAAGGTACGC
GGGAGGCCGTCGAGTTTGATACCGACGCGGGTGTGTACCGCATCTTGACAGCATATACAGCGCCGAGCCAACTGCCCGCAAGCCCCCTCGAGCTCCCAAA
TCAAGTGTGCGCGTATGTCTGGCTCATCCTTCTCTACTCGAGTTTGCTCACGGGTGCTGTCGCCACCCTTGTCTTGCTCGCGTCATTGCGGTCCCCCGGT
TGCCAAGTGTTTGCTTTTCATCGCGTCGCAAGTCTCGTGTGGGTCGGGCGACCCTTTCTTATGCTCCGGGGCACGACGGCTCTCGTGATTCTCAGCACTT
CGCCGATGCAGTTTGCATCGACTGACAGCTTTACGCGCTTCACCTTTGTGCCCCGCACCCCATGGGACGTCATGGTGCTCTCGGGCGAGGCGACGTGGAT
AACGTACGTGCTCGTGGACCTCGCCTTGCCTGGCGCCGAGTCGCACGCCAAGCTGGCTGCGCCACTGAGCGCGCTCATCGCGTGGCTCACGACGCTGCTC
ATCGAGGTAGCCGCACCGTACGAAGCGACGGCAACCTTTGAGCAATCGTGTGAGATCGTCCAACTGGGCCTCGCAGCGTCGTGCACGGGGGGCGTCGTGC
GCATCGGCAGTCGGGAGCGCCTCGGCGTGTTGCTCCTCGTGCACGTTAGCAGCGTCGTCGTTTCGTTTCTGGTAGTGATGGCACGGCAGAGACGAGGTTC
AATCACCGACGTGCGGGGCAGCGACCTCTTGCCGGCGTCGGCGCAAGTTTTCTTGGCGCGCCATGCGACGTGGCACACGCGGCCAACGACCGTGATCATG
GCCGGAATGTTTCCCCTTGGCGGTCGCATGTTTGTCGTCAACCTCTGGCAAGTGCTCGCGGTCAACAACGCACTCCAACTGCCGTCGCAAAGCAGCTACT
CGTGCATCCGAAACTTTACTCTCTGGAAGTTTGGGCTCGTCGAGGTCGGGGGCATTGTATACGTCATCACGTCGGTAGTTGCTAGCTACACGTACATTTA
TGTCTCGTCGACGGCGATGGCCAACGACTTTTGGTGGGCGACCTTCAACGCGACCGGTCACCAGACGTTTGTGACCAACTGGTTTACGCAGCAGCTCCAG
GTCCACCGGAACGGCTCGCACCTCGATCTCACGCAGCTGATCTACAGCGACAACTCAAATTTATACAACACCACAGCCACTGCGATCTCAGTCCCGATGC
TCTACGCAAGCATGATTCAAGACGAAGCCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNATCGAGCCCCCTGGATATAGGCTCTGAGCTCTTTGTCCACGCGATTGGCCCTTTCGGGTCGGTCGCCCTGCGGCGCGTGGCCT
ACCCGGCTTCGCTCGTGTATTGGTACACGCACACGAAAGCATTTTTGAGCCAGCGGCTCGCGTCGGCCAATAGCACTGCTGCTTCCCCGTTTCGAGGCAT
AGGGTCGGCCGTGTCGATCAGCGCTGCGCCGACATTGTGGCAGGAGGGTGTTGCTGCCCGTCCGTTCCTCGGTGGCGACATCACATGTCCGGTGCAAGGG
TCGGGCGAGACCGTCCAAGTGTTTTACTCCAACGTTGGCGTCTGCGCCGGCCACAAAGAAGATGTGCTGGTCGTCGATGGGCTCATGACGACGCAAGCGC
TGCTCGCGCTCGGGCCCGGCGTTGATATTAACGCAACGTGCGCGCACGCAACAATGCAGAGTAGCGGTACCTGCAACGCTGTCTTCCGCGCTTCCCTGCT
CTTCCTCTTGACGCTCTTTTCGGCAGACGAGTGGACATCAGTCTCGAACGCGGCCCCCACGGCGTATCTGCAGAGCGAGCTGCCCGTAGCGATCGCGCAC
TACATCAATGCGTCGACTAGCGACGGCGCCGGGCATATTGAGCTGCGCAACGAGACCGTCCTCGACCCAAGAGACCCGGGGTTCCACGCGTTTGGTTGGC
TCTACCTCTTCGAATGGCTCAGCGGGATCCGCGAAGTCGTGGAATTCCACAGCATCCGTGGGTCCCTAGCCCTTCTCTCGACGCGCAACCCCGTGCACAT
TGGGCCCGTCAACGCGCTCGAGATCCCCGTCAACGTCGCCTTCTTCTTTCGCTGCGAGCTGCTCTACGTGAGCAGTGTCCTCTTGTTCGTGGCGTGTCTC
GCGATCGCGTACATTGCAGCGACGCGCGGCTGCATCGAGGGCTTCAACATGTTCTCGCTGAACCGCGTCACGGGACTCGTCTGGCTCGGGCGGCCGCTTC
TCATGCTCCGCGGCGTCACGGCGCTCTGCCTACTCTCGACGGCCAAGCTCGACCTCGGCGAGTCCCACGGATTCTTCTACCTTGTGTCGCTGCCACAGTC
GTGGTTTACGACCATCATGGCGGCGGGCGAGGCCACATGGGTTGTGTACCTCCTCAACGACGCCTTCTCGATCGTGACGCAGCAGTACACGGCCATTTAT
GCTGATGCGAGCAGCATCGCAGTCTGGATCGCAGCCGCCATCTGGAGCCTCGTGTCGCCCGTCCAGCATCGAGCGACGTTGGCGCGCACCTGCGACGTAG