Transcript Name :
Phyag_g8579
Orientation:
(+)
Number of Exons:
1
Description :
2-isopropylmalate synthase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pyruvate carboxyltransferase41.063PS50991
HmmSmart predictionP-Valprediction_id
2-isopropylmalate synthase LeuA, allosteric (dimerisation) domain1.8SM00917
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-573
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
leucine biosynthetic processGO:0009098IEA
KO ID
K01649
K01649
K01649
K01649
*** None ***
Sequence
        1722 bases(100 bases per row)
ATGATGCAGTCGATCGCCAAGCGCTCGGCCGGCGCCAACGCACGCCGCGCCTTCTCGAAcgtggccgccgccgagGCCGGCAAGGAGCGCCtcatcatct
tcgacacGACCCTGCGCGACGGCGAGCAGTCGCCCGGCGCCACGCTCAACTTTaaggagaagatggacatTGCGCGCGGCCTCAGCGCTCTGGGCGTGGA
CGTGTGCGAGGCGGGTTTCCCCATCTCGTCGCCTGGTGACTTCGAGGCCGTGTCGGCCATCGCCAAGGAGATCGGCCCCATTACGGCGAACCGCGCAACT
GGTGAACCCATGACCATCTGCGGTCTCGCGCGcgccatggagaaggacattCAGCGCTGCTACGACGCTGTGAAGCACGCGCCCAAGCACCGTATCCATA
CGTTCCTGGCCACGTCCGACATCCACCTCCAGTACAAGCTTAAGATCTCGCGCGACGAGTGCATCCGTCGCGCTGTGGACGCCGTCAAGTTCGCCAAGAG
CCTCACCCCGGACGTGGAATTCTCCACGGAGGATGCTGGACGCAGTGACCCCGACTTCTTGACGGAAGTCCTCGCTGAGGTCATTAAGGCCGGCGCTACG
ACGCTCAACATCCCTGACACGGTGGGCTACACGGTCCCTGGCGAATACGGATCGCTCTTCCGCTACCTGATTGACAACACGGAGGGCAGCGACAAGGCTG
TCTTCTCCACGCACTGCCACAACGACCTGGGTCTGGCCACGGCCAACACGCTGTCAGCTGTGCAGGGCGGTGCACGTCAGGTTGAGGTGACGATCAACGG
CATTGGTGAGCGTGCCGGTAACACGGCTCTTGAGGAGCTGGTGATGGCTCTGAAGACCCGCCCGCAGCATTTCCCCGTTTACACGAGTGTGGAGTCGACG
CACATcacacgctgcagccgcaTGGTGAGCCACTACACTGGCATGTCCGTCCAGCCCAACAAGGCCATTGTGGGCTCCAACGCTTTCGCTCACGAGTCCG
GCATCCACCAGGACGGTGTGTTGAAGCACCAGGCTACGTACGAGATCATGCTGCCGGAGTCGGTTGGTTTGAGCGAGAACAAGATGGTGCTCGGCAAGCA
CTCGGGCCGCCACGCGTACAGCaagcgtctccagcagcttggctACACGGACCTCACCCCGGAGGAGCTCGACTACTACGTGGAGAAGTTCAAAGTGCTG
GctgacgagaagaagacggtcACGGACGCTGACATGGAGGCGATTGTGTCGGACGAGCTGTTCAAGCCCGAGGCTTTCTGGACTCTGCAGTCCGTGCACG
TCACCGCTGGTAACCTCGTGAAGCCTACGGCTACGGTCACGCTTGCGCACAAGGACGGCCAGGAGGTGAGCGAGGCTGCTATGGGCACTGGTCCGATTGA
TGCCATCTACGTTGCCATCAAGCGCGCTACGGGCATGGAGAGCATCAAGCTGAACGATTTCTCCGTGGAGAGTGTGACGGACGGCACGTACGCTCTGGGT
GAGGTGACTGTGCGGGTACAGGAAGacaaggaagaggagaagaaaacGGAAGACGAGAAGCACGTGAACGCGCAGACGGGTGTGACGCGTGACCGCCAGT
TCGTTGGCCACGGTGCTAACACGGATATTCTGGTGGCGTCGGCTACGGCCTACGTGAACGCCGTAAACCGCATGATGGCTTCACAgtcgcgtgctgctgc
cgaggcTCGGGTGGGCGCCTAA